The influence of genotypes for kappa-casein gene on the main indicators milk productivity in 1st and 3rd lactation black-and-white Kholmogory cows was studied. genotyping CSN3 carried out by method DNA diagnostics. Cows breed with genotype BB surpass group AA AB yield 166-218 fat 4.9-8.7 kg; 188-298 kg 7.7-10.2 kg, respectively. At same time difference is significant terms mass fraction protein...

κ-casein is a glycosilated protein in mammalian milk that plays an essential role in the milk micelles. control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. transcriptional regulation, a first mechanism for controlling the development of organisms, is carried out by transcription facto...

Somatic cells are present in the milk throughout lactation and consist of leukocytes and epithelial cells exfoliated from the mammary epithelium. Our objective was to determine the efficacy of using somatic cells from goat milk for dynamic studies of gene expression in the mammary gland. Over a 4-wk interval, cells were isolated from daily morning milk samples and samples taken 30 min after mil...

Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...

Alpha s1-, alpha s2-, beta- and kappa-caseins from Somali camels (Camelus dromedarius) were purified by acid precipitation at pH 4.4, crudely separated into an alpha-CN and a beta-CN fraction and further purified by reversed-phase HPLC. Fragments of tryptic digests were sequenced. Amino acid patterns obtained were used to screen a cDNA library constructed from mRNA from lactating udder tissue. ...

κ-casein is a glycosilated protein in mammalian milk that plays an essential role in the milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. Transcriptional regulation, a first mechanism for controlling the development of organisms, is carried out by transcription facto...