Theory is developed for the process of sequencing randomly selected large-insert clones. Genome size, library depth, clone size, and clone distribution are considered relevant properties and perfect overlap detection for contig assembly is assumed. Genome-specific and nonrandom effects are neglected. Order of magnitude analysis indicates library depth is of secondary importance compared to the ...

T-RFLP clone characterization (screening) was optimized for a fast and basepair-accurate characterization of clones from marine Archaea collected from the Eastern Mediterranean Sea. Because of the high sensitivity of T-RFLP fingerprinting, a protocol was developed where 10 initial PCR cycles gave detectable terminal fragments from clones. Additionally, forward and reverse primers for PCR were i...

The prokaryotic diversity and respiratory activity of microbial mat communities on the Markham Ice Shelf and Ward Hunt Ice Shelf in the Canadian high Arctic were analysed. All heterotrophic isolates and > 95% of bacterial 16S rRNA gene clone library sequences from both ice shelves grouped within the phyla Bacteroidetes, Proteobacteria and Actinobacteria. Clone library analyses showed that the b...

BACKGROUND A growing amount of scientific evidence suggests that microbes are involved in the aetiology of irritable bowel syndrome (IBS), and the gastrointestinal (GI) microbiota of individuals suffering from diarrhoea-predominant IBS (IBS-D) is distinguishable from other IBS-subtypes. In our study, the GI microbiota of IBS-D patients was evaluated and compared with healthy controls (HC) by us...

An anaerobic landfill leachate bioreactor was operated with crystalline cellulose and sterile landfill leachate until a steady state was reached. Cellulose hydrolysis, acidogenesis, and methanogenesis were measured. Microorganisms attached to the cellulose surfaces were hypothesized to be the cellulose hydrolyzers. 16S rRNA gene clone libraries were prepared from this attached fraction and also...

Source and Description of Clone: phPAH247, a 2.4 kb EcoSl fragment subcloned into pBR322 from a human liver cDNA library (1).

Two clones that contain goat growth hormone (gGH) genes were isolated from goat genomic library using goat growth hormone cDNA as a probe. One clone CgGH contained gGH1 gene, and another clone, EgGH, contained gGH2 and gGH3 genes. The clone EgGH contained 491 bp inserted sequence, just upstream of the gGH3 gene, which was not present in the clone CgGH. From the sequencing data of the flanking r...

Bacterial artificial chromosome (BAC) libraries have been invaluable tools for the genome-wide genetic dissection of complex organisms. Here, we report the construction and characterization of a high-redundancy BAC library from a very valuable pig breed in China, Wuzhishan miniature pig (Sus scrofa), using its blood cells and fibroblasts, respectively. The library contains approximately 153,600...

The availability of a diverse set of 23S rRNA gene sequences enabled evaluation of the specificity of 39 previously published and 4 newly designed primers specific for bacteria. An extensive clone library constructed using an optimized primer pair resulted in similar gene richness but slightly differing coverage of some phylogenetic groups, compared to a 16S rRNA gene library from the same envi...

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...