Genotyping. Genotypes were confirmed by standard PCR protocols using the following primers: F-Jac_5574 CTGAGGCTGAGACCTAGCGC; R-Jac_6032 CAGCCTCCAATACTGGCAAGAC; R-Jac_7329 GGAAGGGACTTCATCCTGACTG resulting in bands of 459 bp for wt and 187 bp for ko condition. PCRs were performed on tail biopsy after lysis in tail-cut buffer (10 mM Tris HCl pH 8.0, 100 mM NaCl containing Proteinase K at a final c...

The grease matrix was originally introduced as a microcrystal-carrier for serial femtosecond crystallography and has been expanded to applications for various types of proteins, including membrane proteins. However, the grease-based matrix has limited application for oil-sensitive proteins. Here we introduce a grease-free, water-based hyaluronic acid matrix. Applications for proteinase K and ly...

A murine monoclonal anti-DNA antibody ( PME77 ) has been found to bind tightly to the plasma membrane of Raji cells. We show here that this monoclonal anti-DNA antibody reacts in a radioimmunoassay with the cell surface of a variety of mammalian cell types and that the antigenic determinant recognized by the monoclonal anti-DNA antibody at the surface of Raji cells is resistant to DNase. It bel...

The procedure generally used for the isolation of extracellular, cell-associated proteinases of Lactococcus lactis species is based on the release of the proteinases by repeated incubation and washing of the cells in a Ca-free buffer. For L. lactis subsp. cremoris Wg2, as many as five incubations for 30 min at 29 degrees C are needed in order to liberate 95% of the proteinase. Proteinase releas...

Mosquito-borne WNV (West Nile virus) is an emerging global threat. The NS3 proteinase, which is essential for the proteolytic processing of the viral polyprotein precursor, is a promising drug target. We have isolated and biochemically characterized the recombinant, highly active NS3 proteinase. We have determined that the NS3 proteinase functions in a manner that is distantly similar to furin ...

Abstract The principle and the techniques applied in DNA extraction play a pivotal role obtention of purified genetic material. present study investigates efficiency eight protocols Hypostomus commersoni, an essential component South American freshwater ichthyofauna. quality samples was assessed through spectrophotometry, gel electrophoresis, PCR-RAPD markers amplification. influenced both by m...

Steady-state and pre-steady-state kinetics for the hydrolysis of p-nitrophenyl esters of N-alpha-carbobenzoxy(-l-)amino acids catalyzed by leucine-proteinase were determined between pH 5 and 10 (I = 0.1 molar) at 23 +/- 0.5 degrees C. For the substrates considered: (a) the acylation step is rate-limiting in catalysis; (b) the pH profiles of k(cat) and k(cat)/K(m) reflect the ionization of two g...

The N-terminal heparin/fibrin binding domain of human plasma fibronectin (pFN) contains a cryptic proteinase. The enzyme could be generated and activated in the presence of Ca2+ from the purified 70 kDa pFN fragment produced by cathepsin D digestion of pFN. In this work we cloned and expressed the serine proteinase, designated fibronectinase (Fnase), in E. coli. The recombinant pFN protein frag...

High-resolution crystallographic analysis of a complex of the serine-carboxyl proteinase sedolisin with pseudo-iodotyrostatin revealed two molecules of this inhibitor bound in the active site of the enzyme, marking subsites from S3 to S3('). The mode of binding represents two products of the proteolytic reaction. Substrate specificity of sedolisin was investigated using peptide libraries and a ...

We have purified and characterized a neutral proteinase activity from pig uterine myometrium. The proteinase co-purified with the actomyosin complex and could only be separated from it by a high concentration of a chaotropic ion, 3M-NaBr. The proteinase was further purified by gel filtration and affinity chromatography. The purified protein showed a single band on sodium dodecyl sulphate/polyac...