Actin participates in several intracellular trafficking pathways. We now find that actin, bound to the surface of purified yeast vacuoles in the absence of cytosol or cytoskeleton, regulates the last compartment mixing stage of homotypic vacuole fusion. The Cdc42p GTPase is known to be required for vacuole fusion. We now show that proteins of the Cdc42p-regulated actin remodeling cascade (Cdc42...

Actin, an apparently universal component of eukaryotic cells, has been purified from Dictyostelium amoebae to electrophoretic homogeneity. Purification was facilitated by newly discovered solubility properties of actomyosin in 30% sucrose. A quantitative assay for the Dictyostelium actin is described which is based on its ability to activate muscle heavy meromyosin ATPase activity. The specific...

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophor...

Various tissues and cells in culture contain a specific inhibitor of DNase I (EC 3.1.4.5). In this paper evidence is presented that this inhibitor is actin, one of the major structural proteins of muscle and nonmuscle cells. (a) The inhibitor is a major cellular component constituting 5-10% of the soluble protein. (b) It migrates with actin on sodium dodecyl sulfate-polyacrylamide gel electroph...

The inhibitory effect of ketotifen on platelet activating factor (PAF)-induced actin polymerization in a human eosinophilic leukaemia cell line, EoL-1, was examined by flow cytometry with the use of reagents specific for the filamentous form of actin (F-actin). Actin polymerization has been considered to be essential for locomotion of cells, chemotaxis and chemokinesis, and thus it reflects the...

bacillary dysentery, or shigellosis, is a disease of humans in which the colonic epithelium is invaded by bacteria and subjected to inflammatory destruction. the aim of this study was to develop a polymerase chain reaction(pcr) test for detection of virulent shigella spp.. for this purpose, the primers were designed to amplify a 526-bp internal region of the shigella spp. icsa gene, which encod...

To analyze the effects of azalea on oxidative stress, immune factors and vasodilator in hypertensive rats. 24 male Specific-pathogen-free grade spontaneous hypertension rats were divided into model group (normal saline), (50 mg/kg/d azalea), verapamil verapamil) 8 normal control saline) observed changes tail artery systolic pressure for 2-18 w after administration, superoxide dismutase, malondi...

Smooth muscle produces as much stress as skeletal muscle with less myosin. To determine if the actin isoforms specific to smooth muscle contribute to the enhanced force generation, the motility of actin filaments from smooth and skeletal muscle were compared in an in vitro assay in which single fluorescently labeled actin filaments slide over a myosin-coated coverslip. No difference was observe...

Two ancient and highly divergent actin-based cytoskeletal systems have evolved in angiosperms. Plant genomes encode complex actin and actin binding protein (ABP) gene families, most of which are phylogenetically grouped into gene classes with distinct vegetative or constitutive and reproductive expression patterns. In Arabidopsis thaliana, ectopic expression of high levels of a reproductive cla...

Uniform concentrations of chemoattractants such as formylpeptides induced a morphological polarization of human polymorphonuclear leucocytes (PMNs) and a concentration of F-actin at the cell front. They also induced a transient increase in filamentous actin (F-actin) which preceded the cell shape change. We combined fluorescence microscopy and image analysis to study the localization of F-actin...