نتایج جستجو برای: short sequence repeats
تعداد نتایج: 829751 فیلتر نتایج به سال:
Tandem repeats in proteins are patterns of residues repeated directly adjacent to each other. The evolution these can be assessed by using groups homologous sequences, which help pointing events unit duplication or deletion. High pressure a protein family for variation given type repeat might point their function. Here, we propose the analysis families calculate short tandem (pSTRs) sequence an...
Landmark experiments in the 1920s showed that capsule switching is critical for Streptococcus pneumonia survival. Further studies demonstrated that capsule "transformation" occurs via DNA uptake. In this issue of Cell Host and Microbe, Bikard et al. (2012) show that CRISPR-Cas systems inhibit DNA uptake, selecting for the outgrowth of CRISPR-defective pneumococci.
Integrated design , execution , and analysis of arrayed and pooled CRISPR genome editing experiments
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for t...
We have adapted a bacterial CRISPR RNA/Cas9 system to precisely engineer the Drosophila genome and report that Cas9-mediated genomic modifications are efficiently transmitted through the germline. This RNA-guided Cas9 system can be rapidly programmed to generate targeted alleles for probing gene function in Drosophila.
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید