نتایج جستجو برای: short sequence repeats

تعداد نتایج: 829751  

Journal: :Biomolecules 2023

Tandem repeats in proteins are patterns of residues repeated directly adjacent to each other. The evolution these can be assessed by using groups homologous sequences, which help pointing events unit duplication or deletion. High pressure a protein family for variation given type repeat might point their function. Here, we propose the analysis families calculate short tandem (pSTRs) sequence an...

Journal: :Cell host & microbe 2012
Ariel D Weinberger Michael S Gilmore

Landmark experiments in the 1920s showed that capsule switching is critical for Streptococcus pneumonia survival. Further studies demonstrated that capsule "transformation" occurs via DNA uptake. In this issue of Cell Host and Microbe, Bikard et al. (2012) show that CRISPR-Cas systems inhibit DNA uptake, selecting for the outgrowth of CRISPR-defective pneumococci.

2017
Matthew C. Canver Maximilian Haeussler Daniel E. Bauer Stuart H. Orkin Neville E. Sanjana Ophir Shalem Guo-Cheng Yuan Feng Zhang Jean-Paul Concordet Luca Pinello

2017
Jianying Guo Dacheng Ma Rujin Huang Jia Ming Min Ye Kehkooi Kee Zhen Xie

Journal: :Journal of virology 1985
T A Casey W T Ruyechan M N Flora W Reinhold S E Straus J Hay

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for t...

2017
Christopher J. Giuliano Ann Lin Joan C. Smith Ann C. Palladino Jason M. Sheltzer

2013
Scott J. Gratz Alexander M. Cummings Jennifer N. Nguyen Danielle C. Hamm Laura K. Donohue Melissa M. Harrison Jill Wildonger Kate M. O’Connor-Giles

We have adapted a bacterial CRISPR RNA/Cas9 system to precisely engineer the Drosophila genome and report that Cas9-mediated genomic modifications are efficiently transmitted through the germline. This RNA-guided Cas9 system can be rapidly programmed to generate targeted alleles for probing gene function in Drosophila.

2017
Guangchuan Wang Ryan D. Chow Lupeng Ye Christopher D. Guzman Xiaoyun Dai Matthew B. Dong Feng Zhang Phillip A. Sharp Randall J. Platt Sidi Chen

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید