A variety of methods have been developed for cloning PCR products, including blunt-end cloning (1), restriction cut back (2), ligation-independent cloning (3), uracil DNA–glycosylase (UDG) treatment of uracil-containing deoxyoligonucleotide primers (4,5) and TA cloning (6–8). Blunt-end cloning of PCR products often requires treatment of PCR products to polish the ends (9). Even with treatments,...

A PCR-DGGE primer pair, Tyl2F-Tyl4R, specific to plant parasitic and fungivorous nematodes was designed based on the 18S rRNA gene. The results of community analysis using the primers showed that they are specific to the order Tylenchida. This primer pair detected species belonging to Tylenchida with high sensitivity and high resolution. The number of detected species of plant parasitic and fun...

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...

Klebsiella granulomatis is gram-negative bacteria of the genus Klebsiella which causes sexually transmitted disease (STD) Donovanosis and urinary tract infection in older persons. In the present work, in silico approach for primer designing has been implemented; to gather more information about the bacterium. Primer plays an important role to initiate the process of Polymerase Chain Reaction (P...

We have developed a novel double Amplification Refractory Mutation System (double ARMS) using a highly polymorphic region 5' to the human delta-globin gene as a model system. The double ARMS approach involves using two allele-specific ARMS primers simultaneously during DNA amplification by the polymerase chain reaction (PCR). The resulting system is highly sensitive and more specific than singl...

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all pos...

backgrounds and aims: p53 gene is regarded important in pathogenesis of different cancers. therefore, this study aimed to investigate the frequency of p53 gene codon 72 arg/pro polymorphism in women suffering from breast cancer. materials and methods: a total of 90 patients with breast cancer and 83 matched healthy control women participated in this case-control study. genomic dna was extracted...

Thiopurines are clinically useful in the management of diverse immunological and malignant conditions. Nevertheless, these purine analogues can cause lethal myelosuppression, which may be prevented by prospective testing for variants in the thiopurine S-methyltransferase (TPMT) and, in East Asians, Nudix hydrolase 15 (NUDT15) genes. Two single-tube, tetra-primer amplification refractory mutatio...