نتایج جستجو برای: recombinant plasmids
تعداد نتایج: 124414 فیلتر نتایج به سال:
chicken infectious bronchitis virus (ibv) causes severe respiratory and renal dysfunction in chickens. in the present study, we used reverse transcription-polymerase chain reaction (rt-pcr) to amplify the nucleocapsid (n) protein gene of strain massachusetts (mass) h120 of ibv that is commonly used in the vaccine production in iran. the pcr product with the expected size of 1.2 kb was cloned in...
expressions of recombinant proteins for different applications are important objectives in molecular biotechnology; however, expression of some recombinant proteins is difficult. several methods have been designed for expression of these proteins. the aim of this study was to construct a vector containing mtb32c fragment of mycobacterium tuberculosis (m.tuberculosis) as a fusion partner in orde...
Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally desig...
Plasmids containing the same origin of replication (pBBR1MCS-2 Km and pBBR1MCS-3 Tc) have been used to express simultaneous and independently different proteins in P. putida U and in E. coli. Thus, when P. putida was transformed with different genetic constructions made in the same plasmid (pBBR1MCS-3 Tc), or with plasmids containing the same replication origin but with different antibiotic res...
Background: Thrombopoietin (TPO) is an important cytokine that has a critical role in regulating hematopoietic stem cells (HSCs) proliferation and megakaryocyte differentiation. Because of scares amount of this protein in human plasma, in many biotechnological centers around the world, recombinant production of this protein has been carried out. This study was aiming to gene cloning and express...
Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNA in their 1.4 and 1.1 Md EcoRI fragments, respectively. These two tRNA sequences are identical and are; 5'-TCCTCAGTAGCT CAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATCCTACTTGGGGAG-3. Each tRNA gene is located at about ...
The aim of this study was to express and purify recombinant proteins based on human prostate stem cell antigen (PSCA) and heat shock protein-70 (HSP70). The PSCA gene and various structural domains of HSP70 were amplified by polymerase chain reaction (PCR) with the respective primers. Then, the PSCA was cloned into the prokaryotic expression vector pET21a(+) with the amino-terminus, carboxyl-te...
We report here the construction of a vector derived from pET3-His and pRSET plasmids for the expression and purification of recombinant proteins in Escherichia coli based on T7 phage RNA polymerase. The resulting pAE plasmid combined the advantages of both vectors: small size (pRSET), expression of a short 6XHis tag at N-terminus (pET3-His) and a high copy number of plasmid (pRSET). The small s...
A 6.1 kb DNA probe for the human enteric pathogen Campylobacter jejuni has been isolated from a genomic library constructed in the plasmid vector pBR322 in Escherichia coli. The DNA sequence used as a probe was identified from recombinant plasmids following immunological screening of transformants using polyclonal antisera to whole cells and to membrane antigens of C. jejuni. Restriction endonu...
Background: Follicle stimulating hormone is a heterodimeric protein composed of two subunits, α and ß, which are linked noncovalently. The hypophysial gonadotropin FSH plays an important role in the regulation of oocyte maturation, and a key component for growth of ovulator follicles in ewes. Materials and Methods: This study seeks to clone and express the ovine follicle stimulating hormone sub...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید