Factor - dependent Growth in Carcinoma Cell Lines Product Provides Keratinocyte Growth sam Domain of K - Preferential Expression of the Third Immunoglobulin - like Updated

Previously, we identified an amplified gene in a stomach cancer cell line, KATO-III, and designated it K-sam. This gene was later found to be identical with a gene for a receptor tyrosine kinase, bek/FGFR2. One of the characteristics of the K.sam gene is structural diversity of its transcripts; K-sam complementary DNA (cDNA) cloned from human brain (K-sam-I) has a completely different sequence at the third extracelinlar immunoglobulin-like domain as compared to that of the K-sam cDNA derived from KATO-III cells (K-sam-II). Recent study has revealed that this difference signifies a differential ligand affinity; the receptor encoded by the K.sam-I cDNA has a high affinity for basic fibroblast growth factor (bFGF), while the K-sam-II cDNA corresponds to a receptor with the high affinity for keratinocyte growth factor (KGF). Reverse transcription-po. iymerase chain reaction and RNA blot analysis showed that the K-samII-type transcript was present in carcinoma call lines but not in any of the sarcoma cell lines examined. The K-sam-I-type transcript was expressed in both carcinoma and sarcoma cell lines. Furthermore, KGF enhanced the DNA synthesis of the esophageal cancer cells, TE-1, in a dose-dependent manner, while the effect of bFGF was not substantial. In contrast, the glioblastoma cell line, A-172, that expressed the bFGF receptor showed a mitogenic response to bFGF but not to KGF. These data suggest that KGF is a growth factor used preferentially in cancer cells, and this preference is based on the presence of the K-sam.II.type receptor in carcinoma cells but not in sarcoma cells due to alternative splicing. from normal human brain cDNA library, and K-sam-II cDNA was from the KATO-III cDNA library (11). Comparison of the K-sam-I and K-sam-II cDNAs revealed completely different nucleotide sequences in the second half of the third extracellular Ig-like domain; this region of the K-sam-II cDNA was identical to that of the KGF receptor, which showed high-affinity binding to KGF but not to bFGF, whereas the corresponding region of the K-sam-I cDNA was identical to that of human bek, which is the high-affinity receptor for bFGF but not for KGF (8, 12-16). A genomic analysis around the third Ig-like domain of K-sam/bek suggests that the K-sam-II-type and K-sam-Itype messages are transcribed from the same gene by an alternative splicing mechanism (14, 15, 17). We and others have also noted that there are several other splicing variations for the K-sam-I-type and K-sam-II-type transcripts, including those with and without the first Ig-like domain. Here we report that the K-sam-II-type transcript was expressed only in human cancer cells of epithelial origin, or carcinoma cells, while none of five cancer cells of nonepithelial origin, or sarcoma cells, expressed the K-sam-II transcript. We further showed the stimulation of [3H]thymidine uptake by KGF, but not by bFGF, in a carcinoma cell line containing the K-sam-II-type transcript. In contrast, [3H]thymidine uptake of a sarcoma cell line expressing the K-sam-I-type transcript was stimulated by bFGF but not by KGE I N T R O D U C T I O N We previously reported a receptor tyrosine kinase gene, K-sam, which was isolated as an amplified gene in a human stomach cancer cell line, KATO-III, by the in-gel DNA renaturation method (1-3). The K-sam-related genes, N-sam and sam3, have been identified (4, 5). An analysis of the nucleotide sequences of the K-sam, N-sam, and sam3 cDNAs 3 revealed that they are members of the FGFR gene family (4--6). At least four distinct FGFRs, that is, FGFR1, FGFR2, FGFR3, and FGFR4, have been isolated to date (7-10); K-sam is identical to the human bek/FGFR2 gene (6), N-sam is identical to human FLG/FGFR1 (4), and sam3 is presumably the rodent counterpart of human FGFR3 (5). We have identified at least four types of K-sam cDNA from various sources (11). K-sam-I and K-sam-II cDNAs encode membrane-bound receptors, whereas K-sam-Ill and K-sam-IV appear to represent secretory forms of the K-sam receptors. K-sam-I cDNA was cloned Received 7/16/93; accepted 11/8/93. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. a Supported in part by a Grant-in-Aid for the Comprehensive 10-year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan; by Grants-in-Aid for Cancer Research from the Ministry of Health and Welfare of Japan and from the Ministry of Education, Science, and Culture of Japan; by the Uehara Memorial Foundation; and by the Bristol-Myers Squibb Foundation. H. Is., Y. H., H. It., T. K., and T. Y. were awardees of Research Resident Fellowships from the Foundation for Promotion of Cancer Research. 2 To whom requests for reprints should be addressed. 3 The abbreviations used are: cDNA, complementary DNA; FGFR, fibroblast growth factor receptor; Ig, immunoglobulin; KGF, keratinocyte growth factor; bFGF, basic FGF; FCS, fetal calf serum; PCR, polymerase chain reaction; RT-PCR, reverse transcriptionpolymerase chain reaction; Tin, melting temperature; MTI', 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl tetrazolium bromide. M A T E R I A L S A N D M E T H O D S Cells, Culture Conditions, and RNA Preparation. Thirteen cancer cell lines, five sarcoma cell lines, an immature teratoma cell line, and a TE-10 esophageal cancer cell line were used in the present studies (Table 1). KATOIII, HSC-39, MKN45, Lu-143, Lu-140, Lu-135, PC-13, PC-10, PC-3, PC-l, A549, and NCC-IT cells were maintained in RPMI 1640 supplemented with 10% FCS, while TE-1, TE-10, A-172, HT-1080, RD, G-361, and G-402 cells were cultured in RPMI 1640 with 7% FCS, RPMI 1640 with 7% FCS, Dulbecco's modified Eagle's medium with 10% FCS, Eagle's minimum essential medium with 10% fetal bovine serum, Eagle's minimum essential medium with 10% FCS, McCoy's medium with 10% fetal bovine serum, and McCoy's medium with 10% FCS, respectively. Extraction of total RNA from these cultured cells was performed as described elsewhere (18). Polyadenylated RNAs from the human fetal brain and the adult brain were purchased from Clontech (Palo Alto, CA). RT-PCR. cDNA was synthesized from 1 /xg of total RNAs or 0.2 /xg of polyadenylated RNAs using M-MLV reverse transcriptase (GIBCO BRL, Gaithersburg, MD). We designed the following three pairs of primers (Fig. 1): upstream primer K7-7, 5'-CACTCGGGGATAAATAG'Iq'CCAATGC-3', and downstream primer K7-11, 5'-TCCAGGCGCTTGCTGTITFGG-3', for the K-sam-II-type second half of the third Ig-like domain; upstream primer PK-9, 5'-AGATTGAGGTrCTCTATATI'C-3', and downstream primer PK-12, 5'TATCCTCACCAGCGGGGTGTF-3', for the K-sam-I-type transcript; upstream primer NS-10, 5'-CAGATCITGAAGACTGCTGGA-3', and downstream primer NS-13, 5'-GCTAGCATGGGAGTCCCACTG-3', for the N-sam-type transcript. PCR was carried out for 30 cycles. The thermal cycle conditions were: denaturation at 94~ for 30 s; annealing at 65~ for the K-sam-II-type transcript (Tm= 71~ 58~ for the K-sam-I-type transcript (Tin = 61~ or 62~ for the N-sam-type transcript (Tm= 65~ for every 30 s; and extension at 72~ for 1 min. The products were separated by electrophoresis in a 3% agarose gel. The nucleotide sequence of the K-sam-II,