Adhesion under Shear Flow

The 4 integrin, 4 7, plays an important role in recruiting circulating lymphocytes to the gastrointestinal tract, where its ligand mucosal addressin cell adhesion molecule-1 (MAdCAM-1) is preferentially expressed on high endothelial venules (HEVs). Dual antagonists of 4 1 and 4 7, N-(2,6-dichlorobenzoyl)-(L)-4-(2 ,6 -bis-methoxyphenyl)phenylalanine (TR14035) and N-{N-[(3,5-dichlorobenzene)sulfonyl]-2-(R)-methylpropyl}-(D)-phenylalanine (compound 1), were tested for their ability to block the binding of 4 7-expressing cells to soluble ligand in suspension and under in vitro and in vivo shear flow. Compound 1 and TR14035 blocked the binding of human 4 7 to an I-MAdCAM-Ig fusion protein with IC50 values of 2.93 and 0.75 nM, respectively. Both compounds inhibited binding of soluble ligands to 4 1 or 4 7 on cells of human or rodent origin with similar potency. Under shear flow in vitro, TR14035 and compound 1 blocked binding of human 4 7-expressing RPMI-8866 cells or murine mesenteric lymph node lymphocytes to MAdCAM-Ig with IC50 values of 0.1 and 1 M, respectively. Intravital microscopy was used to quantitate 4-dependent adhesion of fluorescent murine lymphocytes in Peyer’s patch HEVs. When cells were prestimulated with 2 mM Mn to activate 4 7 binding to ligand, anti4 monoclonal antibody (mAb) [10 mg/kg (mpk) i.v.] blocked adhesion by 95%, and anti1 mAb did not block adhesion, demonstrating that this interaction was dependent on 4 7. TR14035 blocked adhesion to HEVs [ED50 of 0.01–0.1 mpk i.v.], and compound 1 blocked adhesion by 47% at 10 mpk i.v. Thus, 4 7/ 4 1 antagonists blocked 4 7-dependent adhesion of lymphocytes to HEVs under both in vitro and in vivo shear flow. The ability of lymphocytes to arrest under conditions of vascular flow enables their movement into both normal lymphoid tissues and sites of inflammation. Lymphocyte recruitment in the vasculature is regulated by the differential expression and activation of homing receptors (selectins and integrins) on lymphocytes that interact with counter-receptors of the Ig superfamily on high endothelial venules (HEVs) (Bargatze and Butcher, 1993; Bargatze et al., 1995). This interaction mediates a multistep process, involving rolling and tethering of leukocytes to endothelial ligands, rapid activation of integrins by locally released chemokines, stable adhesion of activated integrins to endothelial ligands, and transendothelial migration through the vessel wall (Bargatze et al., 1995; Warnock et al., 2000). Although all integrins expressed on leukocytes can mediate firm adhesion, 4 7 and 4 1 are members of a small subset of integrins that can also mediate rolling (Berlin et al., 1995). Mucosal addressin cell adhesion molecule-1 (MAdCAM-1), expressed on HEVs of Peyer’s patch and other gut-associated lymphoid tissues (GALTs), is the principal ligand for 4 7, an integrin highly expressed on gut-homing memory lymphocytes (Berlin et al., 1993; Shyjan et al., 1996; Briskin et al., 1997). 4 7 binds to MAdCAM-1 with higher affinity than to VCAM-1 or the CS-1 subdomain of human fibronectin. Although both 4 7 and 4 1 can bind VCAM-1 and CS-1, 4 1 does not bind MAdCAM-1 (Berlin et al., 1993). Both L-selectin and 4 7 mediate the initial attachment and rolling of lymphocytes by interacting with MAdCAM-1, whereas 4 7 ABBREVIATIONS: HEV, high endothelial venule; MAdCAM-1, mucosal addressin cell adhesion molecule-1; GALT, gut-associated lymphoid tissue; mAb, monoclonal antibody; mpk, milligrams per kilogram; VCAM-1, vascular cell adhesion molecule-1; PCR, polymerase chain reaction; DMSO, dimethyl sulfoxide; bp, base pair(s); GFP, green fluorescent protein; FACS, fluorescence-activated cell sorting; MLN, murine mesenteric lymph node; HBSS, Hanks’ balanced salt solution; Ab, antibody; AUC, area under the curve; LFA-1, lymphocyte function antigen-1; ICAM, intercellular adhesion molecule; compound 1, N-{N-[(3,5-dichlorobenzene)sulfonyl]-2-(R)-methylpropyl}-(D)-phenylalanine; compound 2, N-{N-[(3chlorobenzene)sulfonyl] azetidine-2-(S)-carboxyl}-(L)-4-(2 ,6 -bis-methoxyphenyl)phenylalanine; TR14035, N-(2,6-dichlorobenzoyl)-(L)-4-(2 ,6 bis-methoxyphenyl)phenylalanine. 0022-3565/02/3021-153–162$7.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 302, No. 1 Copyright © 2002 by The American Society for Pharmacology and Experimental Therapeutics 4788/988060 JPET 302:153–162, 2002 Printed in U.S.A. 153 at A PE T Jornals on N ovem er 3, 2017 jpet.asjournals.org D ow nladed from also mediates the firm adhesion of lymphocytes via this ligand (Rott et al., 1996). Lymphocyte trafficking in the GALT not only enables normal immune responses (Butcher and Picker, 1996) but also contributes to unwanted inflammation (Podolsky and Fiocchi, 2000). Gut inflammation can induce dramatic changes in the extent and selectivity of lymphocyte recruitment to the gut wall (Briskin et al., 1997; Picarella et al., 1997). For example, the expression of MAdCAM-1 can be up-regulated by as much as 5-fold on blood vessels at sites of intestinal inflammation (Briskin et al., 1997), and proinflammatory cytokines facilitate the recruitment of lymphocytes and other leukocytes to sites of active inflammation (Podolsky and Fiocchi, 2000). The tissue-specific distribution of MAdCAM-1 and selective interaction with gut-homing memory lymphocytes expressing 4 7 suggest a contributing role of this ligandreceptor pair to inflammatory bowel diseases such as Crohn’s disease and ulcerative colitis. Blockade of 4 7 and MAdCAM-1 with antibodies defines their role in models of inflammatory bowel disease. Monoclonal antibodies (mAbs) directed against 4 or 4 7 block lymphocyte homing to intestinal sites in naı̈ve mice (Hamann et al., 1994), and mAbs against 7 or MAdCAM-1 reduce inflammation in mouse models of colitis (Picarella et al., 1997; Kato et al., 2000). In the cotton-top tamarin, which spontaneously develops colitis, an anti4 7 mAb effectively resolved the established colitis (Hesterberg et al., 1996). Perhaps the strongest argument for the importance of 4 integrins in mediating inflammation of the gut is derived from recent clinical trials with Antegren (anti4; Elan/Biogen, Cambridge, MA). In a blinded placebo-controlled phase II trial of 248 patients with moderate-to-severe Crohn’s disease, Antegren administered at a single dose of 3 mpk i.v. resulted in a 46% remission rate after 6 weeks, versus 27% remission with placebo (Ghosh et al., 2001). We have identified a dual 4 7/ 4 1 antagonist by evaluating the ability of the compound to block the binding of human or murine 4 7-expressing cells to soluble human or murine MAdCAM-Ig. Small molecule antagonists of 4 7 that block the static adhesion of human 4 7-expressing cells to the CS-1 subdomain of human fibronectin, human VCAMIg, human MAdCAM-Ig, or murine MAdCAM-Ig have been described previously (Shroff et al., 1996, 1998; Carson et al., 1997; Harriman et al., 1999; Martin et al., 1999). The ability of 4 7 antagonists to block the binding of murine 4 7expressing cells to soluble murine MAdCAM-Ig under static conditions has also been reported (Martin et al., 1999), but the ability of compounds to block ligand binding under in vitro or in vivo shear flow conditions has not been examined. We used in vitro shear flow assays to quantitate the adhesion of both human and murine 4 7-expressing cells to human and murine MAdCAM-Ig, and we characterized the ability of compounds to inhibit adhesion to HEVs in an in vivo model. Materials and Methods Antibodies and Cell Lines The following purified monoclonal antibodies were obtained from BD PharMingen (San Diego, CA): 4B4 (mouse anti-human 1), FIB27 (rat anti-mouse 7 that cross-reacts with human 7), DATK32 (rat anti-mouse 4 7), Ha2/5 (hamster anti-rat 1 that cross-reacts with murine 1; Mendrick and Kelly, 1993), MEL-14 (rat anti-mouse L-selectin), and isotype controls (hamster IgM, rat IgG2b, and rat IgG2a). HP2/1 (mouse anti-human 4) was obtained from Beckman Coulter, Inc. (Fullerton, CA). PS/2 (rat anti-mouse 4) (Miyake et al., 1991) and a matched isotype control (rat anti-human Ras Ab) were supplied by LigoCyte (Bozeman, MT). The following cell lines were used: RPMI-8866 cells (human B cell line) obtained from J. Wilkins (University of Manitoba, Winnipeg, MB, Canada), TK-1 cells (murine T cell line) obtained from I. Weissman (Stanford University, Stanford, CA) (Holzmann and Weissman, 1989), and Jurkat (human T cell line) and RBL-2H3 cells (rat mucosal-type mast cell line) from American Type Culture Collection (Manassas, VA). Expression and Purification of Cellular Adhesion Molecule-Immunoglobulin Fusion Proteins Human MAdCAM-Ig. Domains 1 and 2 of human MAdCAM-1 (GenBank no. U43628) were amplified by PCR using human small intestinal cDNA (Invitrogen, Carlsbad, CA) as a template and the following primer sequences: 5 -PCR primer, 5 -ATTAGGAATTCGCCACCATGGATTTCGGACTGGCCCTCCTGCTGG-3 ; and 3 -PCR primer, 5 AATTGGGATCCACTTACCTGTGGAGGTCGGGCTGTGCAGGACGGGGATG-3 . PCR was performed in the presence of 10% DMSO with KlenTaq (CLONTECH, Palo Alto, CA) in a thermocycler (MJ Research, Waltham, MA) by using 40 cycles with the following parameters: 45 s at 94°C, 45 s at 60°C, and 90 s at 72°C. The resulting PCR product of 660 bp was digested with EcoRI and BamHI and ligated into a pIg (R & D Systems, Minneapolis, MN) expression vector. The pIg vector contains the genomic fragment that encodes the hinge region, CH2 and CH3 of human IgG1 (GenBank no. Z17370), and the fragment encoding human MAdCAM-1 (hMAdCAM-1) was ligated proximal to the IgG1 region. The sequence of the resulting hMAdCAM-1 fragment fused to human IgG1 was verified using Sequenase (U.S. Biochemical Corp., Cleveland, OH). The fragment encoding the entire MAdCAM-Ig fusion was subsequently excised from the pIg vector with EcoRI and NotI and ligated to pcDNA3.1/neo (Invitrogen). The resulting vector, pcDNA3.1/neo-MAdCAM-Ig, was transfected into CHOKI cells (CCL61; American Type Culture Collection) by electroporation and grown under selection with 0.7 mg/ml G418 (Invitrogen). Culture supernatants from single cell clones were assayed by Ig enzyme-linked immunosorbent assay, and a high expressing clone (1 g/ ml) was adapted to CHO-SFM II serum-free media (Invitrogen) for largescale expression. hMAdCAM-Ig was purified from crude culture supernatants by affinity chromatography on protein A/G Sepharose and dialyzed into 50 mM sodium phosphate buffer, pH 7.6. Murine MAdCAM-Ig. The entire extracellular domain of murine MAdCAM-1 (domain 1, domain 2, mucin, and domain 3) (GenBank no. L21203) was amplified by PCR using murine small intestinal cDNA (Invitrogen) as a template and the following primer sequences: 5 -PCR primer, 5 -CCGAGATATCGCCACCATGGAATCCATCCTGGCCCTCCTG-3 ; and 3 -PCR primer, 5 -CCTTGGATCCACTTACCTGTGGTGGAGGAGGAATTCGGGGTCA-3 . PCR was performed in the presence of 10% DMSO with KlenTaq (CLONTECH) in a thermocycler (MJ Research) by using 30 cycles with the following parameters: 1 min at 94°C, 1 min at 60°C, and 2 min at 72°C. The resulting PCR product of 1095 bp was digested with EcoRV and BamHI and ligated into a pIg (R & D Systems) expression vector. After verification of the sequence, the fragment encoding the entire MAdCAM-Ig fusion was excised from the pIg vector with EcoRI and NotI and ligated into pCMV-I/IRES/GFP puro vector (Cell & Molecular Technologies, Inc., Phillipsburg, NJ). The resulting vector carrying the gene for GFP was used to transfect CHOKI cells that were grown in the presence of 4 g/ml puromycin. Transfected cells were sorted by flow cytometry on the basis of their high GFP expression, and the GFP expression was followed during subsequent culture, before the isolation of single cell clones. Culture supernatants from single cell clones were assayed by Ig enzyme-linked immunosorbent assay and immunoblot using anti-murine MAdCAM-1 mAb (MECA367; BD PharMingen). A high expressing clone (1 g/ml) was adapted to CHO-SFM II serum-free media (Invitrogen) for large154 Egger et al. at A PE T Jornals on N ovem er 3, 2017 jpet.asjournals.org D ow nladed from scale expression, and mMAdCAM-Ig was purified as described for hMAdCAM-Ig. Human VCAM-Ig. Domains 1 and 2 of human VCAM-1 (GenBank no. M30257) were amplified by PCR using the human VCAM-1 cDNA (R & D Systems) as a template and the following primer sequences: 3 -PCR primer, 5 -AATTATAATTTGATCAACTTACCTGTCAATTCTTTTACAGCCTGCC-3 ; and 5 -PCR primer, 5 -ATAGGAATTCCAGCTGCCACCATGCCTGGGAAGATGGTCG-3 . PCR was performed for 30 cycles using the following parameters: 1 min at 94°C, 2 min at 55°C, and 2 min at 72°C using a DNA thermal cycler (model 480; PerkinElmer Instruments, Norwalk, CT). The resulting PCR product of 650 bp was digested with EcoRI and BclI and ligated into a pIg (R & D Systems) expression vector. After verification of the sequence, the fragment encoding the entire VCAM-Ig fusion was excised from the pIg vector with EcoRI and NotI and ligated to pCI-neo (Promega, Madison, WI). The resulting vector, pCI-neo/ VCAM-Ig, was transfected into CHOKI cells by calcium phosphate DNA precipitation and grown under selection with 0.4 mg/ml G418. Culture supernatants from single cell clones were assayed for the ability to support Jurkat cell adhesion, and a high expressing clone (1 g/ml) was adapted to CHO-SFM II serum-free media. VCAM-Ig was purified as described for hMAdCAM-Ig. Ligand Binding Assays for 4 7 and 4 1 A ligand binding assay for 4 7 was performed by incubating RPMI-8866 cells (7.5 10 cells/well) or TK-1 cells (1 10 cells/ well) with 200 pM iodinated human or murine MAdCAM-Ig in a 96-well filter binding format. A ligand binding assay for 4 1 has been described previously (Hagmann et al., 2001) and was performed by incubating Jurkat cells (5 10 cells/well) or RBL-2H3 cells (4 10 cells/well) with 100 pM iodinated VCAM-Ig in a 96-well filter binding format. Purified VCAM-Ig and MAdCAM-Ig were labeled with I using Bolton Hunter reagent and purified using highperformance liquid chromatography gel filtration chromatography. Specific radioactivities were in excess of 1100 Ci/mmol. Compounds were evaluated by incubating radioligand compound (prepared in DMSO; 1% DMSO final concentration), cells, and binding buffer (25 mM HEPES, 150 mM NaCl, 3 mM KCl, 2 mM glucose, and 0.1% bovine serum albumin, with 1 mM MnCl2, pH 7.4) at 25°C for 30 min ( 4 1 assays) or 45 min ( 4 7 assays) in a 96-well multiscreen MHVBN filtration plate (Millipore, Bedford, MA). After filtration and a single wash with binding buffer, the filtration plates were dried and transferred to adaptor plates (Packard BioScience, Meriden, CT). After adding 100 l of Microscint-20 (Packard Bioscience) to each well, the plates were sealed, placed on a shaker for 1 min, and counted on a Packard BioScience TopCount. Wells containing cells radioligand 1 M compound or DMSO alone served as controls to calculate 100 and 0% inhibition, respectively. Quantitative FACS Analysis A total of 10 RPMI-8866 or Jurkat cells were incubated for 30 min on ice in FACS buffer (phosphate-buffered saline with Ca /Mg , 5% fetal bovine serum, 100 g/ml goat IgG, and 0.05% sodium azide) containing saturating levels of the following polyethylene-conjugated antibodies: FIB504 rat anti-mouse 7 (2.4 g/ml; cross-reacts with human 7), MAR4 mouse anti-human 1 (80 g/ml), 9F10 mouse anti-human 4 (10 g/ml), and mIgG1 isotype and rIgG2a isotype controls. Similarly, a total of 10 TK-1 or murine mesenteric lymph node (MLN) lymphocytes were incubated for 30 min on ice in FACS buffer with Fc block (10 g/ml; BD PharMingen) containing DATK32-PE rat anti-mouse 4 7 (10 g/ml) or rIgG2a-PE isotype control antibodies. All polyethylene-conjugated antibodies were obtained from BD PharMingen. Cells were washed in FACS buffer and resuspended in FACS buffer containing 1 g/ml propidium iodide. Cells were analyzed by FACScan flow cytometer (BD Biosciences, Franklin Lakes, NJ). Standardized quantum R-PE microbeads (Flow Cytometry Standards Corp., Fishers, IN) were analyzed by flow cytometry and used to create a calibration curve that relates mean fluorescence intensities to molecules of equivalent soluble fluorescence for use in calculating receptor density values. In Vitro Shear Flow Adhesion Assay An in vitro shear flow system adapted from published methods (Berlin et al., 1993) was used to evaluate the ability of compounds to block the binding of human RPMI-8866 cells or murine MLN lymphocytes (2 10 cells/ml) isolated from BALB/c mice to capillary tubes coated with murine or human MAdCAM-Ig, respectively. Cells at a density of 6 10 cells/ml were preincubated with test compounds (0.06–6 M; final DMSO 1%), neutralizing mAb, or isotype control mAb at 0.6 M in buffer (HBSS without Ca /Mg , 20 mM HEPES, 2 mM Mn , and 2% human serum, pH 7.0) for 10 min at 37°C. A 500l cell suspension was then injected into a closed loop flow system that contained 2.5 ml of assay buffer (HBSS with Ca / Mg , 20 mM HEPES, and 2% human serum, pH 7.0). Murine assays included preincubation of cells with anti-L-selectin at 0.6 M to block L-selectin-dependent rolling due to interactions with the mucin domain of mMAdCAM-Ig. A silicone tubing loop and roller pump were used to circulate cells through a MAdCAM-Ig-coated capillary tube mounted on an inverted microscope stage. MAdCAM-Ig was titrated (5, 10, and 50 g/ml), and 50 g/ml was selected for use because it supported 50 to 150 interacting cells/field after 15 min of continuous shear flow. The shear rate was 2 dynes/cm for the first 5 min and 1.2 dynes/cm for the last 10 min, simulating physiological shear flow, where noninteracting lymphocytes have a midline velocity of 4000 m/s in murine HEVs (Bargatze et al., 1995). Cells were monitored for 15 min by videomicroscopy, and the number of adherent cells was determined at 1-min intervals by analysis of individual frames using either a customized Proteo-Flow computer analysis package (LigoCyte Pharmaceuticals) or manual counting directly from the monitor screen. Control adhesion for individual experiments was based on the isotype or 1% DMSO control treatment. Data are represented as area under the curve (AUC) from time 0 to 15 min. Data were normalized by calculating percentage of control adhesion within each experiment, with two to six tests evaluated per treatment. Interaction of Lymphocytes with High Endothelial Venules in Murine Peyer’s Patches Compounds were evaluated for their ability to block the interactions of lymphocytes with high endothelial venules in murine Peyer’s patches using an intravital microscopy system adapted from published methods (Bargatze et al., 1995). In brief, murine MLN lymphocytes were isolated from normal donor BALB/c mice and fluorescently labeled with rhodamine (MitoTracker Orange CM-H2-TMRos) or fluorescein (carboxy-4 ,5 -dimethylfluorescein diacetate) purchased from Molecular Probes (Eugene, OR). After labeling, cells were incubated in EDTA buffer (HBSS without Ca /Mg , 10 mM HEPES, and 2 mM EDTA) for 10 min at 25°C, washed in buffer (HBSS without Ca /Mg and 10 mM HEPES), resuspended in activating buffer (HBSS without Ca /Mg , 10 mM HEPES, and 2 mM Ca /Mn ), and treated with anti-L-selectin Ab at 200 g/ml for 5 min for rhodamine-labeled cells to maintain both a saturating in vitro and in vivo concentration of mAb and at 50 g/ml for 5 min before i.v. injection for fluorescein-labeled cells to provide a saturating in vitro concentration. Syngeneic recipient BALB/c mice were anesthetized and prepared for intravital microscopy by abdominal incision to exteriorize the small intestines, and a selected Peyer’s patch was gel mounted and positioned for epifluorescence videomicroscopy. The protocol used to evaluate the effect of mAb or compounds on the binding of murine lymphocytes to Peyer’s patch HEVs by intravital microscopy is described in Scheme 1. At time 10 min, rhodamine-labeled cells were injected by i.v. bolus into the tail vein and monitored for 10 min to document control adhesion events in each animal. The same high endothelial field was monitored during the entire time course. Compounds were prepared 4 7-Dependent Adhesion under Shear Flow 155 at A PE T Jornals on N ovem er 3, 2017 jpet.asjournals.org D ow nladed from in HBSS containing 1% DMSO and 2% polyethylene glycol-400. Compounds (0.01–10 mpk) or mAbs (10 mpk) were then dosed by i.v. injection 5 min before the i.v. injection of 1.5 10 fluoresceinlabeled MLN lymphocytes. In some experiments, fluorescein-labeled cells were also incubated with compounds (100 M) for 10 min before injection. After monitoring the adhesion of fluorescein-labeled cells for 10 min, anti4 (PS/2; 10 mpk) was injected i.v., and cell adhesion was monitored for another 10 min to quantitate 4-independent baseline adhesion as a negative control. A single HEV field containing multiple venules (3–5) was evaluated for each animal. Interacting cells were determined at 1-min intervals by analysis of individual frames using either a customized computer analysis package (LigoCyte Pharmaceuticals) or manual counting directly from the monitor screen to obtain statistically significant values when evaluating four to six mice per treatment group. The ability of mAbs or compounds to reverse established lymphocyte interactions with murine Peyer’s patch HEVs was evaluated as described in Scheme 2. For experiments involving only fluoresceinlabeled cells, these cells were preincubated with anti-L-selectin mAb at 200 g/ml for 5 min before i.v. injection to maintain both a saturating in vitro and in vivo concentration of mAb. At time 14 to 4 min, 1.5 10 fluorescein-labeled MLN lymphocytes were injected by i.v. bolus into the tail vein and monitored for 10 min to document control adhesion events in each animal. Compounds (10 mpk) or mAbs (10 mpk) were then dosed by i.v. injection, and adhesion events were monitored for another 10 min. For compoundtreated animals, anti4 (PS/2; 10 mpk) was dosed by i.v. injection 10 min after compound treatment, and cell interactions were monitored for another 10 min. Interacting cells were quantitated as described