Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

نویسندگان

  • R A Gramzinski
  • D L Doolan
  • M Sedegah
  • H L Davis
  • A M Krieg
  • S L Hoffman
چکیده

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

A protective role of locally administered immunostimulatory CpG oligodeoxynucleotide in a mouse model of genital herpes infection.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) are known as potent activators of the immune system and inducers of several Th1-associated immunomodulatory cytokines. We therefore investigated whether such a CpG-containing ODN (CpG ODN) given mucosally in the female genital tract could enhance innate immunity and protect against genital herpes infection...

متن کامل

Immunostimulatory CpG oligodeoxynucleotide confers protection in a murine model of infection with Burkholderia pseudomallei.

Although CpG oligodeoxynucleotides (CpG ODNs) are known to enhance resistance against infection in a number of animal models, little is known about the CpG-induced protection against acute fatal sepsis such as that associated with the highly virulent bacterium Burkholderia pseudomallei. We previously demonstrated in an in vitro study that immunostimulatory CpG ODN 1826 enhances phagocytosis of ...

متن کامل

CpG oligodeoxynucleotide and Montanide ISA 51 adjuvant combination enhanced the protective efficacy of a subunit malaria vaccine.

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP1(19)) of the...

متن کامل

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of ...

متن کامل

Low doses of killed parasite in CpG elicit vigorous CD4+ T cell responses against blood-stage malaria in mice.

Development of a vaccine that targets blood-stage malaria parasites is imperative if we are to sustainably reduce the morbidity and mortality caused by this infection. Such a vaccine should elicit long-lasting immune responses against conserved determinants in the parasite population. Most blood-stage vaccines, however, induce protective antibodies against surface antigens, which tend to be pol...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Infection and immunity

دوره 69 3  شماره 

صفحات  -

تاریخ انتشار 2001