The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

نویسندگان

  • H Hori
  • M Sawada
  • S Osawa
  • K Murao
  • H Ishikura
چکیده

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The ribosomal genes of Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the ge...

متن کامل

Molecular evolution of Mycoplasma capricolum subsp. capripneumoniae strains, based on polymorphisms in the 16S rRNA genes.

Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia w...

متن کامل

Molecular characterization of Mycoplasma synoviae isolates from commercial chickens in Iran

Detection of Mycoplasma synoviae (MS) by culture and polymerase chain reaction (PCR) has been reported from commercial chicken farms in different provinces of Iran. In some reports the phylogenetic analysis of MS isolates based on 16S rRNA and variable lipoprotein hemagglutinin (vlhA) genes have been carried out. The PCR product containing partial 16S rRNA genes of Iranain isolates was sequence...

متن کامل

Promoters of Mycoplasma capricolum ribosomal RNA operons: identical activities but different regulation in homologous and heterologous cells

The 5' region of the rRNA operon, rrnA, of M. capricolum was cloned. Sequence analysis revealed two tRNA genes, tRNA(leu) and tRNA(lys), upstream to the promoter of the rRNA operon. The in vivo transcription start sites of the rRNA operon and of the tRNA genes were mapped. The same promoters used by M. capricolum RNA polymerase are also recognized by E. coli RNA polymerase both in vivo and in v...

متن کامل

Detection of Mcs4 Rna Genes in Mycoplasma Capricolum Subsp. Capricolum Type Strain California Kid and Strain Gm262g

MCS4 RNA (125 nucleotides in length) is as abundant 5S rRNA in the cell and is encoded by two genes – mcs4a and mcs4b. We detected MCS4 RNA genes by random amplified polymorphic analysis (RAPD) and Southern hybridization technique. In our studies the genomic polymorphisms of Mycoplasma capricolum subsp. capricolum type strain California kid (ATCC 27343) and strain GM262G (ATCC 43092) were not d...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Nucleic acids research

دوره 9 20  شماره 

صفحات  -

تاریخ انتشار 1981