15-Hydroxyeicosatetraenoic Acid Is a Preferential Peroxisome Proliferator-Activated Receptor / Agonist

Peroxisome proliferator-activated receptor (PPARs) modulate target gene expression in response to unsaturated fatty acid ligands, such as arachidonic acid (AA). Here, we report that the AA metabolite 15-hydroxyeicosatetraenoic acid (15HETE) activates the ligand-dependent activation domain (AF2) of PPAR / in vivo, competes with synthetic agonists in a PPAR / ligand binding assay in vitro, and triggers the interaction of PPAR / with coactivator peptides. These agonistic effects were also seen with PPAR and PPAR , but to a significantly weaker extent. We further show that 15-HETE strongly induces the expression of the bona fide PPAR target gene Angptl4 in a PPAR / -dependent manner and, conversely, that inhibition of 15-HETE synthesis reduces PPAR / transcriptional activity. Consistent with its function as an agonistic ligand, 15-HETE triggers profound changes in chromatin-associated PPAR / complexes in vivo, including the recruitment of the coactivator cAMP response element-binding protein binding protein. Both 15R-HETE and 15S-HETE are similarly potent at inducing PPAR / coactivator binding and transcriptional activation, indicating that 15-HETE enantiomers generated by different pathways function as PPAR / agonists. Peroxisome proliferator-activated receptor/ (PPAR / ) is a ligand-regulated transcription factor that modulates target gene expression in response to certain fatty acids and fatty acid derivatives (Forman et al., 1997; Desvergne et al., 2006). PPAR / forms heterodimers with the nuclear receptor RXR that bind to peroxisome proliferator response elements (PPREs) in target genes. A major function of the ligand in this context is to induce a conformational change in PPAR / that results in the displacement of interacting corepressors, such as silencing mediator for retinoid and thyroid (SMRT) receptors and SMRT/histone deacetylase-associated repressor protein (SHARP), by specific coactivators, such as sequential recruitment of steroid receptor coactivator-1 (SRC-1) and p300/CBP, resulting in transcriptional activation (Yu and Reddy, 2007; Zoete et al., 2007). PPAR / can regulate genes also by different mechanisms. Thus, PPAR / ligands repress pro-inflammatory gene expression by releasing the hematopoietic transcriptional repressor Bcl-6 from a complex with PPAR / (Lee et al., 2003). In another study (Matsusue et al., 2006), it was reported that PPAR / can repress genes by sequestering RXR from other RXR-dependent nuclear receptors. PPAR / plays an important role in the regulation of energy homeostasis, lipid catabolism, and glucose homeostasis (Desvergne et al., 2006) but also has essential functions in This work was supported by the Deutsche Forschungsgemeinschaft [Grants SFB-TR17/A3, Se263/17-1] and the Landes-Offensive zur Entwicklung wissenschaftlich-ökonomischer Exzellenz-Schwerpunkt “Tumor and Inflammation” of the state of Hesse. Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.109.060541. ABBREVIATIONS: PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor; PPRE, peroxisome proliferator responsive element; CBP, cAMP response element-binding protein binding protein; GW501516, 2-[2-methyl-4-([4-methyl-2-[4-(trifluoromethyl)phenyl)-1,3thiazol-5-yl]methylsulfanyl]phenoxy]acetic acid; L165,041, [4-[3-(4-acetyl-3-hydroxy-2-propylphenoxy)propoxy]phenoxy]acetic acid; AA, arachidonic acid; LBD, ligand binding domain; PG, prostaglandin; 15R-HETE, 15(R)-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid; 15S-HETE, 15(S)hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid; HPETE, hydroperoxyeicosatetraenoic acid; COX, cyclo-oxygenase; LOX, lipoxygenase; NDGA, nordihydroguaiaretic acid; EDBCA, ethyl-3,4-dihydroxy-benzylidene-cyanoacetate; GW1929, N-(2-benzoylphenyl)-O-[2-(methyl-2-pyridinylamino)ethyl]-L-tyrosine hydrochloride; LX, lipoxin; GW7647, 2-[[4-[2-[[(cyclohexylamino)carbonyl](4-cyclohexylbutyl)amino]ethyl]phenyl]thio]-2methylpropanoic acid; CHO, Chinese hamster ovary; DMEM, Dulbecco’s modified Eagle’s medium; FCS, fetal calf serum; PCR, polymerase chain reaction; qPCR, quantitative polymerase chain reaction; siRNA, small interfering RNA; PIPES, piperazine-N,N -bis(2-ethanesulfonic acid); NP40, nonidet P40; TR-FRET, time-resolved fluorescence resonance energy transfer; LC, liquid chromatography; TATAi, TATA initiator module; PGC1 , peroxisome proliferator-activated receptor coactivator 1 ; Angptl4, angiopoietin-like 4; Cre, cyclization recombination. 0026-895X/10/7702-171–184$20.00 MOLECULAR PHARMACOLOGY Vol. 77, No. 2 Copyright © 2010 The American Society for Pharmacology and Experimental Therapeutics 60541/3553214 Mol Pharmacol 77:171–184, 2010 Printed in U.S.A. 171 at A PE T Jornals on N ovem er 7, 2017 m oharm .aspeurnals.org D ow nladed from developmental processes, differentiation, and wound healing. Mice lacking PPAR / show an aberrant development and malfunction of the placenta (Peters et al., 2000; Barak et al., 2002; Nadra et al., 2006) and exhibit a defect in wound healing (Michalik et al., 2001). PPAR / is critical for the survival, differentiation, and proliferation of keratinocytes (Peters et al., 2000; Di-Poï et al., 2002; Burdick et al., 2006), and promotes the differentiation of Paneth cells in the intestinal crypts (Varnat et al., 2006). However, PPAR / also plays a role in cancer and inflammation: it modulates intestinal tumorigenesis with diverging effects in different mouse models (Peters et al., 2000; Barak et al., 2002; Di-Poï et al., 2002; Gupta et al., 2004; Wang et al., 2004; Burdick et al., 2006), inhibits chemically induced skin carcinogenesis (Kim et al., 2004; Bility et al., 2008), exerts an essential function in the tumor stroma (Abdollahi et al., 2007; Müller-Brüsselbach et al., 2007), and has potent anti-inflammatory activities (Kilgore and Billin, 2008). Therefore, PPAR / represents a highly relevant drug target for the treatment of major human diseases, which has helped lead to the development of several synthetic drug candidates with subtype selectivity and highaffinity binding, such as GW501516 and L165,041 (Peraza et al., 2006). One of the fatty acids that induces PPAR / activity to a moderate extent is AA. It has been shown that AA is a low-affinity ligand that interacts with the PPAR / LBD (Xu et al., 1999), raising the possibility that the agonistic effect of AA is due directly to its interaction with PPAR / . On the other hand, metabolites of AA may also account for this effect. Prostanoids are major AA metabolites generated by the combined action of cyclooxygenases and prostaglandin or thromboxane synthases. Prostaglandin I2 (PGI2; prostacyclin) has indeed been postulated to act as a PPAR / agonist (Gupta et al., 2000; Hatae et al., 2001), but this issue remains controversial (Yu et al., 1995; Forman et al., 1996; Fauti et al., 2006). Another major group of eicosanoid metabolites is generated by the lipoxygenases (Pidgeon et al., 2007), but lipoxygenase products of AA acting as bona fide PPAR / ligands have not yet been described. 15-Hydroxyeicosatetraenoic acid (15-HETE) has been reported to activate PPAR / in a reporter assay in keratinocytes, but it remains unclear whether this involves a direct interaction with the PPAR / LBD or indirect mechanisms (Thuillier et al., 2002). In the present study, we have systematically addressed this question using mouse fibroblasts as a model system. We show that the agonistic effect of AA is due largely to its lipoxygenase-mediated oxidation to 15-HPETE and the subsequent enzymatic conversion to 15-HETE. Consistent with this finding, 15-HETE enabled the interaction of PPAR / with coactivator peptides in vitro, and interacted with PPAR / in a competitive ligand-binding assay. Furthermore, 15-HETE induced the PPAR / target gene Angptl4 (Mandard et al., 2004) in a clearly PPAR / -dependent manner. Both enantiomers of 15-HETE, 15R-HETE and 15SHETE, showed similar agonistic properties, indicating that different pathways converge on PPAR / . Whereas 15SHETE is generated by LOX pathways, 15R-HETE is synthesized by cytochrome P450 or acetylated COX-2 (Clària et al., 1996; Clària and Serhan, 1995; Gilroy, 2005; Romano, 2006; Titos et al., 1999). Collectively, our findings demonstrate that 15-HETE enantiomers produced by different signaling pathways function as ligands for PPAR / and induce its transcriptional activity. Materials and Methods Chemicals. GW501516, 9-cis-retinoic acid, and the LOX inhibitors NDGA and EDBCA were purchased from Axxora (Lörrach, Germany) and prostaglandins D2, E2, and F2 from Cayman Europe (Tallinn, Estonia). GW1929 was obtained from Cayman Europe; LXA4 from BIOMOL (Hamburg, Germany); and GW7647 and diclofenac from Sigma-Aldrich (Steinheim, Germany). All other eicosanoids were from Cayman Europe and Axxora (Lörrach, Germany). Mouse Strains. Pparb/d-null and wild-type mice have been described previously (Peters et al., 2000). Pparb/d mice (Barak et al., 2002) harboring a floxed Pparb/d exon 4 were kindly provided by R. Evans. Cell Culture. Pparb/d-null, wild-type, and floxed fibroblasts were established from fetal lungs and cultured as described previously (Müller-Brüsselbach et al., 2007). WPMY-1 cells were obtained from the American Type Culture Collection (Manassas, VA). A CHO cell line with a stably integrated pFR-Luc reporter gene (Stratagene/ Agilent Technologies, Waldbronn, Germany), which expresses luciferase under the control of five Gal4 DNA binding sites and stably expresses a Gal4-hPparb fusion protein, was generated by successive electroporation of the two vector constructs. After selection in G418, the cells were cloned by limited dilution, and positive clones were identified using a charge-coupled device camera. The cell clone showing the best response to synthetic PPAR / ligands was chosen for this study. All cells were maintained in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 g/ml streptomycin in a humidified incubator at 37°C and 5% CO2. Plasmids. pCMX-mPpar (Forman et al., 1997) and Gal4-mPpar (Shi et al., 2002) were kindly provided by Dr. R. Evans. 3 FLAGPPAR / was generated by cloning the coding sequence of mPPAR / N-terminally fused to a triple FLAG tag (Müller-Brüsselbach et al., 2007) into pcDNA3.1( ) zeo (Invitrogen, Karlsruhe, Germany). pCMX-empty has been described previously (Umesono et al., 1991). LexA-PPAR / , 7L-TATA initiator module (TATAi), and 10 Gal4SVGL3 have been described previously (Jérôme and Müller, 1998; Fauti et al., 2006). LexA-PPAR and LexA-PPAR were constructed in a fashion analogous to the construction of LexAPPAR / . pSG5-hRxRa containing the full-length RxRa cDNA was kindly provided by Dr. A. Baniahmad. The PPRE-TATAi plasmid was constructed by inserting a PPRE containing fragment of the third intron of the human ANGPTL4 gene (Mandard et al., 2004) into TATAi-pGL3 (Jérôme and Müller, 1998). The pUC18 plasmid was obtained from New England Biolabs (Frankfurt am Main, Germany), and pcDNA3.1 was obtained from Invitrogen (Karlsruhe, Germany). Transfections and Luciferase Reporter Assays. Transfections were performed with polyethylenimine (average mol. wt., 25,000; Sigma-Aldrich). Cells were transfected on 12-well plates at 70 to 80% confluence in DMEM plus 2% FCS with 2.5 g of plasmid DNA and 2.5 l of polyethylenimine (1:1000 dilution, adjusted to pH 7.0 and preincubated for 15 min in 100 l of phosphate-buffered saline for complex formation). Four hours after transfection, the medium was changed and cells were incubated in normal growth medium for 24 h. Luciferase assays were performed as described previously (Gehrke et al., 2003). Values from three independent experiments were combined to calculate averages and standard deviations. Retrovirally Transduced Cells Expressing FLAG-PPAR . 3 FLAG-PPAR / was cloned into the retroviral vector pLPCX (Clontech, Mountain View, CA). Phoenix cells expressing ecotropic env were transfected with 3 FLAG-mPPARb-pLPCX as described elsewhere (http://www.stanford.edu/group/nolan/retroviral_systems/ retsys.html). Culture supernatant was used to infect Pparb-null fetal mouse lung fibroblasts that had previously been established from 172 Naruhn et al. at A PE T Jornals on N ovem er 7, 2017 m oharm .aspeurnals.org D ow nladed from Pparb-knockout mice by standard procedures. Cells were selected with puromycin (2 g/ml; Sigma), resulting in a cell population expressing 3 FLAG-mPPAR / at moderate levels. Quantitative PCR. cDNA was synthesized from 1 g of RNA using oligo(dT) primers and the Omniscript kit (QIAGEN, Hilden, Germany). qPCR was performed in a Mx3000P real-time PCR system (Stratagene, La Jolla, CA) for 40 cycles at an annealing temperature of 60°C. PCR reactions were carried out using the Absolute QPCR SYBR Green Mix (ABgene, Hamburg, Germany) and a primer concentration of 0.2 M according to the manufacturer’s instructions. L27 was used as normalizer. Comparative expression analyses were statistically analyzed by Student’s t test (two-tailed, equal variance). The following primers were used: Pparb: forward, 5 CTCCATCGTCAACAAAGACG; reverse, 5 -TCTTCTTTAGCCACTGCATC; Angptl4: forward, 5 -CTC TGG GGT CTC CAC CAT TT; reverse, 5 -TTG GGG ATC TCC GAA GCC AT; L27: forward, 5 -AAA GCC GTC ATC GTG AAG AAC; reverse, 5 -GCT GTC ACT TTC CGG GGA TAG. siRNA Transfections. For siRNA transfection, cells were seeded at a density of 5 10 cells per 6-cm dish in 4 ml of DMEM with 10% FCS and cultured overnight. Four hundred picomoles of siRNA in 500 l of OptiMEM (Invitrogen) and 10 l of Lipofectamine 2000 (Invitrogen) in 500 l of OptiMEM were separately incubated for 5 min at room temperature, mixed, and incubated for another 20 min. The siRNA-lipid complex was added to the cells cultured in DMEM without FCS (time 0), and the medium was changed to normal growth medium after 6 h. Cells were passaged and replated 48 h after transfection at a density of 5 10 cells per 6-cm dish. Transfection was repeated 72 h after start of the experiment, and cells were passaged after another 24 h. Forty-eight hours after the last transfection, cells were stimulated and harvested after 3 h for RNA isolation. The following siRNAs were used: Pparb siRNA1 (CCGCATGAAGCTCGAGTATGA; QIAGEN); Pparb siRNA2 (CAAGTTCGAGTTTGCTGTCAA; QIAGEN); control siRNA (Alexa Fluor 488labeled nonsilencing duplex siRNA; QIAGEN). Chromatin Immunoprecipitation Analysis. WPMY-1 cells were grown to confluence. After stimulation, the cells were fixed by addition of 37% formaldehyde to a final concentration of 1%. Incubation time was 10 min at room temperature. Glycine was added to a final concentration of 125 mM for 5 min. After two washes with ice-cold phosphate-buffered saline, the cells were pelleted for 5 min at 1200 g. Pellets were resuspended in cold hypotonic lysis buffer [5 mM PIPES, pH 8.0, 85 mM KCl, 0.5% (v/v) NP40, and protease inhibitor cocktail (Sigma)] at a ratio of 1 ml per 10 cells and incubated on ice for 20 min. Nuclei were pelleted by centrifugation as before and resuspended in radioimmunoprecipitation assay buffer [10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% (v/v) NP40, 1% sodium deoxycholate, 0.1% (w/v) SDS, 1 mM EDTA, and protease inhibitors] at a ratio of 1 ml per 10 nuclei. Soluble chromatin was prepared by sonication with a microtip using a sonifier (S-250D; Branson Ultrasonics Corporation, Danbury, CT) set to 1-s pulse, 2-s pause. Eighty pulses were applied. After centrifugation at 16,000g for 15 min in a tabletop centrifuge, the supernatant was collected. An aliquot was incubated overnight with proteinase K and RNase A at 65°C and loaded on a 1% agarose gel to estimate shearing efficiency. The supernatant was precleared by addition of protein A Sepharose beads (Invitrogen), which were previously blocked in radioimmunoprecipitation assay buffer with 1 mg/ml bovine serum albumin, 0.4 mg/ml sonicated salmon sperm DNA (Stratagene), and protease inhibitors, coupled to rabbit IgG (Sigma I5006). After rotation for 1 h at 4°C, the beads were removed by centrifugation. The supernatant was used for immunpreciptiations. Four micrograms of antibody [rabbit IgG pool, Sigma; -PPAR / , -CBP, Santa Cruz Biostechnology (Santa Cruz, CA); -acetylated H4, Millipore (Billerica, MA)] were added to 300 l of precleared chromatin corresponding to 3 10 nuclei and incubated overnight at 4°C with mild rotation. After addition of blocked Sepharose beads, incubation time was 1 h at 4°C with mild rotation. The beads were washed once with 1 ml of chilled mixed micelle buffer [20 mM Tris, pH 8.1, 150 mM NaCl, 2 mM EDTA, 0.1% (w/v) SDS, and 1% (v/v) Triton X-100], once with buffer 500 [20 mM Tris, pH 8.1, 500 mM NaCl, 2 mM EDTA, 0.1% (w/v) SDS, and 1% (v/v) Triton X-100], twice with LiCl detergent buffer (10 mM Tris, pH 8.1, 250 mM LiCl, 1% (v/v) NP40, 1% (w/v) sodium deoxycholate, and 1 mM EDTA), and twice with room-temperature Tris-EDTA. Complexes were eluted twice with 250 l of elution buffer [1% SDS (w/v) and 100 mM NaHCO3]. Supernatants were pooled; adjusted to 180 mM NaCl, 35 mM Tris, pH 6.5, and 9 mM EDTA; and incubated with 20 g of proteinase K and 10 g of RNase A for 65°C overnight. DNA was purified using a PCR purification kit (QIAGEN). Eluates were quantified by qPCR employing the Ct method relative to an amount equivalent to 1% of DNA used for immunoprecipitation. Standard deviations were calculated from triplicate measurements considering Gaussian error propagation. The following primers were used: ANGPTL4: PPRE, forward: CCT TAC TGG ATG GGA GGA AAG; reverse, CCC AGA GTG ACC AGG AAG AC. Time-Resolved Fluorescence Resonance Energy Transfer Assays in Vitro. TR-FRET (Stafslien et al., 2007) was performed with the LanthaScreen TR-FRET PPAR / competitive binding assay and the LanthaScreen TR-FRET PPAR , PPAR / , and PPAR coactivator assays according to the instructions of the manufacturer (Invitrogen). Incubation time was 60 min for all assays shown in this study. All assays were validated for their robustness by determining the respective Z -factors (Zhang et al., 1999). Measurements were performed on a VICTOR3V Multilabel Counter (WALLAC 1420; PerkinElmer Life and Analytical Sciences, Rodgau, Germany) with instrument settings as described in the manufacturer’s instructions for LanthaScreen assays. The following peptides were used for the coactivator recruitment assay: PGC1 , EAEEPSLLKKLLLAPANTQ; C33, HVEMHPLLMGLLMESQWGA; CBP, AASKHKQLSELLRGGSGSS; PPAR -interacting protein, VTLTSPLLVNLLQSDISAG; TRAP220, NTKNHPMLMNLLKDNPAQD. Quantification of HETEs in Cell Culture Supernatants by Liquid Chromatography/Tandem Mass Spectrometry. Cell culture supernatants were spiked with 1 ng of deuterated internal standards and acidified with 20 l of saturated NH4Cl solution containing 1.25 M HCl. The analytes were extracted with 1 ml of diisopropyl ether and, after complete drying, resolved in acetonitrile/ water [1:1 (v/v)]. For determination, a 10l aliquot was injected into the LC/tandem mass spectrometry. The LC/MS analysis was carried out on a mass spectrometer (API3000; Applied Biosystems, Foster City, CA) equipped with two Series 200 LC Micro Pumps (PerkinElmer Life and Analytical Sciences, Waltham, MA), a CTC HTC PAL autosampler (CTC Analytics, Zwingen, Switzerland), a turbo-ion interface and a HSID interface (Ionics Mass Spectrometer Group Inc., Bolton, ON, Canada). The flow rate was set to 200 l/min, and a C18 column (5 cm 2 mm, 3m particles) was used. A generic LC gradient of 10 min was used for sample separation. Solvents were water/acetonitrile (95:5) (A) and acetonitrile/water (95:5) (B), both containing 0.2% acetic acid. The gradient profile used was 40% solvent A for 0 to 2 min linearly increasing to 100% within 7 min. Mass spectrometer conditions were: scan type, multiple reaction monitoring with negative polarity; ion-spray voltage, 4200 V; temperature, 350°C; collision gas, 4 psi; all potentials (declustering, focusing, entrance and exit potential) were optimized for each ion. Collision energy was 20 eV, and the following transitions were used for quantitation: 319.2/114.9 (5-HETE), 327.2/115.9 (d8-5-HETE), 319.2/154.2 (8-HETE), 319.2/207.8 (12-HETE), 327.2/214.1 (d8-12HETE), 319.2/218.9 (15-HETE), and 327.2/182.0 (d8-15-HETE). Dwell time was 300 ms each. All chemicals and solvents were obtained from Merck (Darmstadt, Germany).