The role of AMPK and PPARγ1 in exercise-induced lipoprotein lipase in skeletal muscle

16 Exercise can effectively ameliorate type 2 diabetes and insulin resistance. Here we show that the 17 mRNA levels of one of peroxisome proliferator-activated receptor (PPAR) family members, 18 PPARγ1, and genes related to energy metabolism, including PPARγ coactivator-1 protein α 19 (PGC-1α) and lipoprotein lipase (LPL), increased in the gastrocnemius muscle of habitual 20 exercise-trained mice. When mice were intraperitoneally administered an AMP-activated 21 protein kinase (AMPK) activator 5-Aminoimidazole-4-carboxamide ribonucleoside (AICAR), 22 the mRNA levels of the aforementioned three genes increased in gastrocnemius muscle. AICAR 23 treatment to C2C12 differentiated myotubes also increased PPARγ1 mRNA levels, but not 24 PPARα and δ mRNA levels, concomitant with increased PGC-1α mRNA levels. An AMPK 25 inhibitor, compound C, blocked these AICAR effects. AICAR treatment increased the half-life 26 of PPARγ1 mRNA by nearly 3-fold (4 h 12 h) by activating AMPK. When C2C12 myoblast 27 cells infected with a PPARγ1 expression lentivirus were differentiated into myotubes, PPARγ1 28 overexpression dramatically increased LPL mRNA levels by more than 40-fold. In contrast, 29 when PPARγ1 expression was suppressed in C2C12 myotubes, LPL mRNA levels significantly 30 reduced and the effect of AICAR on increased LPL gene expression was almost completely 31 blocked. These results indicated that PPARγ1 was intimately involved in LPL gene expression 32 in skeletal muscle and the AMPK-PPARγ1 pathway may play a role in exercise-induced LPL 33 expression. Thus, we identified a novel critical role for PPARγ1 in response to AMPK activation 34 for controlling the expression of a subset of genes associated with metabolic regulation in 35 skeletal muscle. 36 37 INTRODUCTION 38 Physical exercise has beneficial effects on general health and results in increased catabolism of 39 glucose and fatty acids as energy sources in skeletal muscle. AMPK and its related cellular 40 signaling pathways are thought to play a critical role in exercise-mediated adaptations in the 41 muscle (19). AMPK is an evolutionarily conserved heterotrimer that consists of α-catalytic and 42 βand γ-regulatory subunits and is a regulator of energy homeostasis. AMPK is activated by an 43 increased AMP:ATP ratio associated with ATP consumption during exercise (3,30). Activated 44 AMPK drives several energy production systems, including glucose uptake, fatty acid oxidation, 45 and mitochondria biogenesis, to maintain energy balance. Because of these beneficial activities, 46 AMPK is considered to be a target for preventing type 2 diabetes. 47 The capacity of muscle to catabolize fatty acids is determined at the transcriptional level for 48 genes involved in fatty acid uptake and catabolism. PPAR α and δ, members of the nuclear 49 receptor superfamily, control the transcription of these genes in the muscle (32). PPARα induces 50 the expression of genes involved in the numerous steps of fatty acid uptake and oxidation in 51 muscle; these genes are shared with PPARδ (5). PPARδ associates with an AMPK α subunit and 52 increases basal and ligand-dependent transcription (16), which suggests that the AMPK-PPARδ 53 pathway may play a critical role in regulating the expressions of numerous genes mediated by 54 exercise. 55 The function of another family member of this family, PPARγ, as a receptor in skeletal muscle 56 remain unclear due to its much lower level of expression as compared with that in adipose 57 tissues. However, it has been reported that physical exercise induced increased PPARγ 58 expression in human skeletal muscle through increased reactive oxygen species (ROS) 59 production and that this effect was blocked by antioxidant supplementation (21). 60 Skeletal muscle is one of the main biosynthetic tissues of LPL, which hydrolyzes triglycerides 61 contained in chylomicrons and VLDL to yield fatty acids for localized uptake by this tissue. The 62 importance of muscle LPL for removing serum triglycerides was determined by analyzing 63 muscle specific LPL-deficient mice (28). These mice exhibited insulin resistance in the liver 64 and adipose tissues and aggravated diet-induced obesity. In addition, a recent study showed that 65 muscle LPL expression in an insulin-resistant offspring was lower than that in controls, which 66 indicated that reduced muscle LPL may cause diabetes (15). The results of these reports suggest 67 a relationship between muscle LPL expression and diabetes although the molecular details of 68 muscle LPL expression mechanisms have not been thoroughly investigated. 69 Until date, a few reports have shown that AMPK regulated LPL expression in cultured 70 skeletal muscle cell lines (17, 18). These findings were consistent with the observation that 71 exercise training induced increased muscle LPL expression (23). However, the mechanism by 72 which AMPK increases LPL expression in skeletal muscle remains unclear. In this study, we 73 show that AMPK induces increased expression of a nuclear receptor PPARγ1 and that this 74 nuclear receptor is a key regulator of LPL expression in C2C12 myotubes. Thus, we identified a 75 new role for the AMPK-PPARγ1 pathway in regulating muscle LPL expression that was 76 induced in response to exercise. 77 78 MATERIALS AND METHODS 79 Cell culture. C2C12 myoblast cells were maintained in Dulbecco’s modified Eagle’s medium 80 (DMEM) supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, and 100μg/ml 81 of streptomycin under 5% CO2 atmosphere. Confluent myoblast cells differentiated into 82 myotubes when cultured in a differentiation medium (2% horse serum, 100 units/ml of 83 penicillin, and 100μg/ml of streptomycin in DMEM) for 4-6 days. 84 85 Western blot. Protein expression and phosphorylation were analyzed by western blotting. 86 C2C12 myotubes and mouse skeletal muscle were lysed with RIPA buffer (50 mM Tris-HCl pH 87 7.4, 1 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, and 0.25% sodium deoxycholate) 88 supplemented with a protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan) and a 89 phosphatase inhibitor cocktail (Sigma Aldrich, St. Louis, MO). Equal amounts of protein (10 90 μg/lane) from mixed cell lysates (n = 3) were subjected to SDS-PAGE (8% gel) and transferred 91 to a polyvinylidene difluoride membrane (Millipore, Billerica, MA). Membranes were probed 92 with either an anti-phospho-AMPKα (Thr172: Cell Signaling Technology, Beverly, MA), an 93 anti-AMPKα (Cell Signaling Technology), an anti-PPARγ (Santa Cruz Biotechnology, Santa 94 Cruz, CA), or an anti-β-actin (Sigma Aldrich) antibody. Subsequently, membranes were 95 exposed to a horseradish peroxidase-coupled secondary antibody, either an anti-mouse (Jackson 96 Immune Research, West Grove, PA) or an anti-rabbit (Jackson immune research) antibody, and 97 then developed using a chemiluminescence-based detection system (Amersham ECL, GE 98 Healthcare, Pittsburgh, PA). 99 100 Real-time quantitative PCR. Total RNA was extracted from C2C12 myotubes or mouse 101 skeletal muscle using ISOGEN (Nippon gene, Tokyo, Japan) according to the manufacturer’s 102 instructions (25). RNA was reverse transcribed using a High Capacity cDNA Reverse 103 Transcription kit (Applied Biosystems). Real-time quantitative PCR (Taqman probe and SYBR 104 green) analysis was performed on StepOnePlus Real-Time PCR Systems (Applied Biosystems). 105 The PCR primers used for measuring mRNA were as follows: for PPARα, 5′106 CTCGCGTGTGATAAAGC -3′ and 5′CGATGCTGTCCTCCTTG -3′; PPARδ, 5′107 GCCTCGGGCTTCCACTAC -3′ and 5′AGATCCGATCGCACTTCTCA -3′; PPARγ1, 5′108 GGACTGTGTGACAGACAAGATTTG -3′ and 5′CTGAATATCAGTGGTTCACCGC -3′; 109 PPARγ2, 5′CTCTGTTTTATGCTGTTATGGGTGA -3′ and 5′110 GGTCAACAGGAGAATCTCCCAG -3′; PGC-1α, 5′TTCTGGGTGGATTGAAGTGGTG -3′ 111 and 5′TGTCAGTGCATCAAATGAGGGC -3′; LPL, 5′CTTCTTGATTTACACGGAGGT -3′ 112 and 5′ATGGCATTTCACAAACACTG -3′; CD36, 5′CTTCCACATTTCCTACATGCAA -3′ 113 and 5′ATCCAGTTATGGGTTCCACATC -3′; UCP-3, 5′GAGTCAGGGGCCTGTGGAAA 114 -3′ and 5′GCGTTCATGTATCGGGTCTT -3′; MyoD, 5′GCTTCTATCGCCGCCACTCC -3′ 115 and 5′CGCACATGCTCATCCTCACG -3′; myogenin, 5′GCATGTAAGGTGTGTAAGAG 116 -3′ and 5′GCGCAGGATCTCCACTTTAG -3′; myosin heavy chain (MyHC), 5′117 TCCAAACCGTCTCTGCACTGTT -3′ and 5′AGCGTACAAAGTGTGGGTGTGT -3′. 118 mRNA expression levels were normalized to 18S ribosomal RNA levels (TaqMan ID: 119 Mm03928990_g1, Applied Biosystems). There were no significant differences in 18S ribosomal 120 RNA levels between treatment conditions. 121 122 Mice. All animal experiments were performed in accordance with the guidelines of the Animal 123 Usage Committee of the University of Tokyo or Nara Women's University. Mice were housed 124 with a 12:12-h light-dark cycle and given free access to water and food. 125 126 Treadmill exercise training. Male C57BL/6 mice (6-week-old) were divided into an exercise 127 group and a control group (n = 4/group). Mice were acclimated to training on a treadmill that 128 was inclined at 10° (15 m/min for 30 min) for 4 weeks (5 times/week). The mice were 129 anesthetized and sacrificed 18 h after the last training, and whole gastrocnemius muscle was 130 rapidly excised, frozen in liquid nitrogen, and stored at -80°C. 131 132 AICAR administration. Male C57B/6J mice (8-week-old) were randomly divided into vehicle 133 (saline) and AICAR (10 mg/ml in saline) treatment groups. The mice were treated for 3 days 134 with either vehicle or AICAR (400mg/kg/day, i.p.). Gastrocnemius muscle was isolated 6 h after 135 the last injection, frozen, and stored at -80°C until analyzed. 136 137 Expression plasmid construction. A pCSII-EF-3Flag-PPARγ1 lentiviral plasmid was 138 constructed by inserting a fragment encoding for 3Flag-tagged mouse PPARγ1 into 139 pCSII-EF-MCS-IRES2-Venus (RIKEN, Saitama, Japan). Lentiviral plasmids for shRNA for 140 mouse PPARγ or control were constructed by recombining pCS-RfA-EG (RIKEN) with 141 pENTR4-H1 (RIKEN) inserted by oligonucleotide DNA for shRNA expression. The target 142 sequences were as follows: PPARγ, 5′AAAAAGTGCAAGAGATCACAGAGTAT -3′ (14), 143 and control (Scramble II Duplex from Dharmacon, Lafayette, CO), 5′144 GCGCGCTTTGTAGGATTCG-3′. 145 146 Lentivirus infection. HEK293T cells were transfected with a lentiviral expression plasmid 147 together with a VSV-G and Rev-expressing (pCMV-VSV-G-RSV-Rev) and packaging plasmid 148 (pCAG-HIVgp). After 12 h, the cells were further cultured in fresh medium containing 10μM 149 forskolin. The medium containing lentiviruses was collected and filtered. C2C12 cells were 150 infected with a lentivirus medium supplemented with 10 μg/ml of polybrene for 24 h. The cells 151 were then replenished with fresh culture medium. 152 153 Drugs. AICAR, H2O2, and GW9662 were purchased from Wako Pure Chemical, Osaka, Japan. 154 Metformin and Compound C were obtained from Sigma Aldrich and Calbiochem (La Jolla, CA) 155 respectively. 156 157 RESULTS 158 Four weeks of exercise or AICAR treatment increased mRNA levels of energy metabolism 159 related genes in mouse skeletal muscle. To determine whether habitual exercise training affected 160 the expression of genes known to be regulated by metabolic changes in skeletal muscle, 161 gastrocnemius muscle was obtained from male C57BL/6 mice that had been acclimated to 162 training on a treadmill inclined at 10° (15 m/min for 30 min) for 4 weeks. Real-time RT-PCR 163 analysis showed that the mRNA levels of energy metabolism related genes, including PGC-1α, 164 LPL, and UCP-3, were significantly increased in the trained mice as compared with those in 165 sedentary mice (Fig. 1A). There was also an increasing trend of CD36 gene expression (P<0.1). 166 Increased gene expression of the PPAR subtype, PPARγ1, but not PPARα or δ, was found after 167 this training. 168 Because AMPK in skeletal muscle is activated by exercise, we hypothesized that these 169 responses were partly caused by AMPK activation in response to habitual exercise. Thus, we 170 treated mice by intraperitoneally administering the AMPK activator AICAR (400 mg/kg/day) 171 for 3.5 days. Real-time RT-PCR analysis showed that the mRNA levels of three genes, those for 172 PPARγ1, PGC-1α, and LPL, in gastrocnemius muscle were significantly increased as was 173 observed in exercise-trained mice (Fig. 1B). CD36 gene expression was significantly increased, 174 whereas the UCP3 mRNA level was only slightly increased in AICAR-treated mice. These 175 results suggested that AMPK activation accounted, at least in part, for the exercise-mediated 176 alterations in the expression of a subset of genes in skeletal muscle, particularly that for PPARγ1. 177 However, we cannot rule out the possibility that AICAR affected muscle gene expression 178 through its pharmacological actions other than AMPK activation (2, 31). 179 180 Activated AMPK induces PPARγ1 gene expression in C2C12 myotubes. To more directly 181 examine this connection, differentiated C2C12 myotubes were cultured with the AMPK 182 activator AICAR and changes in gene expression in these cells were analyzed. First, C2C12 183 cells were cultured with various concentrations of AICAR for 12 h and their whole cell lysates 184 were subjected to immunoblot (Fig. 2A, left panel). Both the phosphorylated AMPK and 185 PPARγ1 protein levels increased in the presence of more than 0.25 mM AICAR. In the 186 following experiments cells were cultured with 1 mM AICAR to substantially activate AMPK. 187 AMPK phosphorylation was observed within 3 h after AICAR treatment and for an additional 9 188 h (Fig. 2A, right panel). In response to AICAR treatment, the PPARγ1 protein level increased 189 concurrently with the appearance of phosphorylated AMPK. Because C2C12 myotubes 190 expressed low levels of PPARγ2 protein, its bands were barely visible in this immunoblot 191 membrane despite its increased mRNA level in response to AICAR (data not shown). The 192 mRNA level of PPARγ1, but not those of PPARα and δ, increased in the presence of AICAR in 193 a time-dependent manner and concurrently with its increased protein level (Fig. 2B). By 194 comparison, the PGC-1α mRNA level increased slowly for more than 9 h after AICAR 195 treatment, which was consistent with previous findings (9). The effect of AICAR to increase the 196 PPARγ1 mRNA levels was abolished after adding an AMPK inhibitor, compound C (Fig. 2C). 197 These results indicated that AMPK activation was involved in increased PPARγ1 expression in 198 myotubes. 199 Physical exercise induced increased PPARγ expression in human skeletal muscle through 200 increased reactive oxygen species (ROS) production and this effect was blocked by antioxidant 201 supplementation (21). Because AMPK was activated by increased ROS levels in H2O2-treated 202 cells (4), we cultured C2C12 myotube cells in the presence of H2O2 for 12 h and changes in 203 AMPK phosphorylation and PPARγ1 protein levels were analyzed in the presence or absence of 204 compound C (Fig. 2D). At the same time, to further confirm the finding that AMPK activation 205 was involved in increased PPARγ1 expression, myotubes were cultured with another AMPK 206 activator, metformin (2 mM), in the presence or absence of compound C. AICAR treatment 207 increased both phosphorylated AMPK and PPARγ1 protein levels, while such increases were 208 abolished by the addition of compound C (lanes 3 and 4). Similarly, both metformin and H2O2 209 increased AMPK phosphorylation and PPARγ1 protein levels only when culture media did not 210 contain compound C (lanes 5 to 7). Taken together, these results imply that physical exercise 211 induces increased PPARγ expression in skeletal muscle by the actions of AMPK via not only 212 decreased ATP levels but also increased ROS levels. 213 214 PPARγ1 mRNA is stabilized in C2C12 myotubes by AICAR. To determine the mechanism by 215 which AICAR induced increased PPARγ1 gene expression, we performed luciferase assays 216 using a reporter gene that contained the 5′ upstream promoter region (2.0 kb) of the mouse 217 PPARγ1 gene. This promoter was not activated by AICAR (data not shown). Thus, we next 218 investigated the stability of PPARγ1 mRNA in C2C12 myotubes in the presence of a 219 transcription inhibitor, actinomycin D. PPARγ1 mRNA was degraded with a half-life of 220 approximately 4 h, and AICAR prolonged this half-life up to 12 h (Fig. 3A). When C2C12 221 myotubes were cultured with AICAR and/or compound C for 9 h, the increased PPARγ1 mRNA 222 level in the presence of AICAR was notably reduced by treatment with compound C; this 223 suggested that AMPK activation was involved in stabilizing PPARγ1 mRNA (Fig. 3B). 224 225 PPARγ1 overexpression dramatically increases LPL gene expression in C2C12 myotubes. 226 Although PPARδ has been shown to play a critical role in the transcriptional regulation of 227 skeletal muscle metabolism (5), the precise role of another family member, PPARγ1, in skeletal 228 muscle remains unclear. To analyze the function of increased PPARγ1 induced in response to 229 AMPK activation, C2C12 myoblasts were infected with a Flag-tagged PPARγ1 expression 230 lentivirus and then allowed to differentiate into myotubes (Fig. 4A). Real-time RT-PCR analysis 231 showed that the LPL mRNA level was dramatically increased by PPARγ1 overexpression 232 (>40-fold) without any changes in the mRNA levels of differentiation marker genes, including 233 myoD, myogenin, and myosin heavy chain (Fig. 4B). CD36 gene expression was also 234 upregulated by PPARγ1 overexpression, whereas UCP-3 and PGC-1α mRNA levels remained 235 unaffected. These results indicated that increased PPARγ1 expression induced by exercise or 236 AICAR treatment (Figs. 1 and 2) was associated with the transcriptional regulation of skeletal 237 muscle metabolism, particularly LPL gene upregulation. 238 When C2C12 myotube cells were cultured in the presence of AICAR for 36 h, the PPARγ1 239 mRNA and protein levels reached a peak between 12 and 24 h, whereas LPL and CD36 mRNA 240 levels significantly increased only at 36 h after AICAR treatment (Fig. 4C). This time lag 241 suggested that LPL and CD36 may be downstream targets of PPARγ1. In addition, increased 242 PGC-1α induced by AICAR may have co-activated PPARγ1, which subsequently induced 243 UCP-3 gene expression at 24 and 36 h despite no increase in UCP-3 mRNA by PPARγ1 244 overexpression alone (Fig. 4A). 245 246 PPARγ1 knockdown abolishes AICAR-induced changes in gene expression in C2C12 myotubes. 247 To determine the relationship between AICAR-mediated AMPK activation and PPARγ1 248 function, PPARγ1 expression in C2C12 myotubes was suppressed using a lentivirus to express 249 shRNA against PPARγ1, after which AICAR effects were assessed. The increase in PPARγ1 250 protein expression in response to AICAR treatment for 12 h was abolished by shRNA against 251 PPARγ1 (Fig. 5A). PPARγ1 knockdown slightly stimulated phosphorylation of AMPK in the 252 presence or absence of AICAR (Fig. 5A) through an as yet uncharacterized mechanism without 253 any effects on gene expression of differentiation markers (Fig. 5B). PPARγ1 knockdown 254 significantly reduced LPL mRNA levels and abolished the increased LPL mRNA level induced 255 by AICAR (Fig. 5C). This suggested that PPARγ1 largely regulated LPL gene expression in 256 myotubes and was strongly associated with the effects of AICAR on LPL gene expression. A 257 similar pattern was observed for UCP-3 gene expression regulation. Although, PPARγ1 258 knockdown only partially reduced UCP-3 mRNA levels in the presence or absence of AICAR. 259 In addition, CD36 and PGC-1α mRNA levels were not affected by PPARγ1 knockdown at the 260 specific time point of 36 h after AICAR treatment. Additionally, when endogenous PPARγ was 261 inhibited by a PPARγ antagonist, GW9662, a similar pattern of the expression of LPL, CD36, 262 and UCP-3 gene was observed (Fig. 5D). 263 264 DISCUSSION 265 The PPARγ isoform, PPARγ2, is expressed at high levels in adipose tissues and plays a critical 266 role as a master regulator of adipocyte differentiation (26). A shorter isoform, PPARγ1, which 267 lacks the 30 amino acid residues at the amino terminus of PPARγ2, is primarily distributed in 268 the muscle, heart, and liver. Because PPARγ expression in muscle is only 5%-10% of its 269 expression in adipose tissue, its physiological roles in muscle has been underestimated. 270 However, a previous report provided evidence for its crucial role in muscle by showing that 271 deleting PPARγ in skeletal muscle caused severe insulin resistance in muscle and that treatment 272 with a PPARγ agonist did not increase skeletal muscle insulin sensitivity in these animals (7). 273 Nevertheless, how PPARγ expression is regulated in skeletal muscle remains unknown. In this 274 report, we showed that exercise caused an increase in PPARγ1 mRNA and protein levels in 275 muscle, which likely occurred because AMPK was activated. Consistent with a previous report 276 (12), we failed to detect increased AMPK phosphorylation in muscle of mice 18 h after exercise 277 or 6 h after AICAR treatment (data not shown). It might be due to the timing of muscle 278 sampling. In contrast, in C2C12 myotubes, we found that both another AMPK activator, 279 metformin, and H2O2 increased phosphorylated AMPK and PPARγ1 levels, and that compound 280 C canceled out these effects, suggesting the importance of AMPK activation for upregulating 281 their expression (Fig. 2D). Moreover, AICAR treatment increased the half-life of PPARγ1 282 mRNA by nearly 3-fold (4 h-12 h; Fig. 3A) through AMPK activation. 283 Current evidence suggests that the stability of rapidly degraded mRNA is controlled through 284 the 3′-untranslated region (UTR) containing an AU-rich element (ARE) that consists of an 285 AUUUA pentamer (1). We found that five AUUU(U)A sequences are conserved in the 3′-UTR 286 for human, mouse, and rat PPARγ1 mRNA (data not shown). One ARE-binding protein, HuR, 287 stabilizes mRNAs that contain AREs in their 3′-UTRs. HuR is phosphorylated by AMPK and 288 then transported to the cytoplasm to facilitate mRNA stability (14). These findings suggest that 289 AMPK activation contributes to increased PPARγ1 mRNA and protein levels through the 290 actions of HuR. At the same time, because luciferase assays employing a limited upstream of 291 the PPARγ1 gene were carried out in this study, we can't rule out the possibility that PPARγ1 292 mRNA synthesis was also increased by AMPK activation (11). 293 Another noteworthy result of the current study was that LPL gene expression in skeletal 294 muscle was predominantly regulated by PPARγ1. Although another PPARγ isoform, PPARγ2, 295 regulates the transcription of a subset of genes in adipocytes, including aP2, LPL, CD36, UCP-1, 296 and adiponectin (8, 27, 29), the target genes of PPARγ in skeletal muscle remain uncertain. Our 297 results in this study showed that in C2C12 myotubes infected with a PPARγ1 expression 298 lentivirus, only LPL gene expression dramatically increased (Fig. 4B). In addition, PPARγ1 299 knockdown significantly suppressed basal LPL gene expression and blocked an 300 AICAR-mediated increase in LPL mRNA levels (Fig. 5C). These results provide clear evidence 301 for the importance of PPARγ1 for regulating LPL expression in skeletal muscle and increasing 302 LPL gene expression by AMPK activation. It seems likely that PPARγ1 indirectly stimulated 303 LPL gene expression because the increase in LPL mRNA level was observed 12-24 h after 304 increased PPARγ1 mRNA in response to AICAR (Fig. 4C), but the precise mechanism remains 305 uncertain at the moment. In contrast, with regard to UCP-3 gene expression, PPARγ1 that is 306 co-activated with increased PGC-1α may partially contribute to an increase in its mRNA level. 307 This is based on our findings that UCP-3 mRNA levels increased concomitantly with increased 308 PPARγ and PGC-1α mRNA levels in the gastrocnemius muscle after physical exercise (Fig. 309 1A); overexpression of only PPARγ1 had no effect on UCP-3 gene expression (Fig. 4B), and 310 PPARγ1 knockdown moderately reduced the UCP-3 mRNA levels in C2C12 myotubes (Fig. 311 5C). Taken together, these results indicate that LPL gene expression is regulated mostly by 312 PPARγ1, whereas UCP-3 gene expression is increased by the combination of PPARγ1, or 313 unknown transcription factor(s) other than PPARγ1, and PGC-1α. 314 It is well known that exercise induces LPL gene expression in human skeletal muscle (22, 23, 24). 315 Because LPL secreted by skeletal muscle promotes the catabolism of triglyceride-rich, atherogenic 316 lipoproteins, LPL activation is thought to exert beneficial effects for preventing of cardiovascular 317 diseases, type 2 diabetes, and metabolic syndrome. The importance of PPARγ1 in skeletal muscle 318 has also been observed in muscle-specific PPARγ-null mice that exhibit severe insulin resistance in 319 muscle (7). In addition, previous report shows that muscle specific LPL overexpression prevents 320 diet-induced obesity (10).These data suggest the beneficial effect of AMPK-PPARγ1-LPL 321 pathway for metabolism. In contrast, another report reveal LPL overexpression in muscle causes 322 insulin resistance in muscle (6) and supports the proposition that only a moderate increase in 323 LPL secreted by skeletal muscle may contribute to a modest uptake of fatty acids that are an 324 energy source in muscle and increase the catabolism of serum triglyceride-rich lipoproteins to 325 reduce the risk of cardiovascular diseases. 326 In summary, we have shown that habitual exercise induced enhanced expression of PPARγ1, 327 PGC-1α, and LPL genes in the skeletal muscle of trained mice (Fig. 6). Increased expression of 328 these genes was also observed in both AICAR-treated mice and C2C12 myotubes cultured with 329 a couple of AMPK activators. The effects of these activators were blocked by treating the cells 330 with an AMPK inhibitor, compound C, which suggested the importance of AMPK activation for 331 enhanced PPARγ1 expression. We also found that AICAR increased the half-life of PPARγ1 332 mRNA by nearly 3-fold through AMPK activation. PPARγ1 overexpression in C2C12 myotubes 333 resulted in dramatically increased LPL mRNA levels, whereas suppressing its expression 334 blocked an AICAR-mediated increase in LPL mRNA. These results indicate that PPARγ1 is335intimately involved in LPL gene expression in skeletal muscle and that exercise induces336increased LPL gene expression likely due to AMPK activation. Overall, these results provide337 compelling evidence showing a novel critical role for PPARγ1 in response to AMPK activation338caused by physical exercise for controlling the expression of a subset of genes associated with339metabolic regulation in skeletal muscle.340341REFERENCES3421. Bevilacqua A, Ceriani MC, Capaccioli S, Nicolin A. Post-transcriptional regulation343of gene expression by degradation of messenger RNAs. J Cell Physiol 195: 356-372,3442003.345 2. Chen HC, Bandyopadhyay G, Sajan MP, Kanoh Y, Standaert M, Farese RV Jr,346Farese RV. Activation of the ERK pathway and atypical protein kinase C isoforms in347exercise and aminoimidazole-4-carboxamide-1-beta-D-riboside (AICAR)-stimulated348glucose transport. J Biol Chem 277: 23554-23562, 2002.3493. Chen ZP, Stephens TJ, Murthy S, Canny BJ, Hargreaves M, Witters LA, Kemp350BE, McConell GK. Effect of exercise intensity on skeletal muscle AMPK signaling in351humans. Diabetes 52: 2205-2212, 2003.3524. Choi SL, Kim SJ, Lee KT, Kim J, Mu J, Birnbaum MJ, Soo Kim S, Ha J. The353Regulation of AMP-activated protein kinase by H2O2. Biochem Biophys Res Commun354287: 92-97, 2001.3555. Ehrenborg E, Krook A. Regulation of skeletal muscle physiology and metabolism by356peroxisome proliferator-activated receptor δ. Phalmacol Rev 61: 373-393, 2009.3576. Ferreira LD, Pulawa LK, Jensen DR, Eckel RH. Overexpressing human lipoprotein358Lipase in mouse skeletal muscle is associated with insulin resistance. Diabetes 50:3591064-1068, 2001.3607. Hevener AL, He W, Barak Y, Le J, Bandyopadhyay G, Olson P, Wilkes J, Evans361RM, Olefsky J. Muscle-specific Pparg deletion causes insulin resistance. Nat Med3629:1491-1497, 2003.3638. Iwaki M, Matsuda M, Maeda N, Funahashi T, Matsuzawa Y, Makishima M,364Shimomura I. Induction of adiponectin, a fat-drived antidiabetic and antiatherogenic365factor, by nuclear receptors. Diabetes 52: 1655-1663, 2003.3669. Jäger S, Handschin C, St-Pierre J, Spiegelman BM. AMP-activated protein kinase367(AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc368Natl Acad Sci U S A 104: 12017-12022, 2007.36910. Jensen DR, Schlaepfer IR, Morin CL, Pennington DS, Marcell T, Ammon SM,370Gutierrez-Hartmann A, Eckel RH. Prevention of diet-induced obesity in transgenic371mice overexpressing skeletal muscle lipoprotein lipase. Am J Physiol 273: R683-R689,3721997.37311. Lachinani L, Ghaedi K, Tanhaei S, Salamian A, Karamali F, Kiani-Esfahani A,374Rabiee F, Yaghmaei P, Baharvand H, Nasr-Esfahani MH. Characterization and375functional assessment of mouse PPARγ1 promoter. Avicenna J Med Biotech 4:376160-169, 2012.37712. Leick L, Fentz J, Biensø RS, Knudsen JG, Jeppesen J, Kiens B, Wojtaszewski JF,378 Pilegaard H. PGC-1α is required for AICAR-induced expression of GLUT4 and379mitochondrial proteins in mouse skeletal muscle. Am J Physiol Endcrinol Metab 299:380E456-465, 2010.38113. Liao W, Nguyen MT, Yoshizaki T, Favelyukis S, Patsouris D, Imamura T, Verma382IM, Olefsky JM. Suppression of PPAR-γ attenuates insulin-stimulated glucose uptake383by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes. Am J Physiol Endcrinol384Metab 293: E219-E227, 2007.38514. Martínez-Chantar ML, Vázquez-Chantada M, Garnacho M, Latasa MU,386Varela-Rey M, Dotor J, Santamaria M, Martínez-Cruz LA, Parada LA, Lu SC,387Mato JM. S–Adenosylmethionine regulates cytoplasmic HuR via AMP–activated388kinase. Gastroenterology 131: 223–232, 2006.38915. Morino K, Petersen KF, Sono S, Choi CS, Samuel VT, Lin A, Gallo A, Zhao H,390Kashiwagi A, Goldberg IJ, Wang H, Eckel RH, Maegawa H, Shulman GI.391Regulation of mitochondrial biogenesis by lipoprotein lipase in muscle of392insulin-resistant offspring of parents with type 2 diabetes. Diabetes. 61: 877-887,3932012.39416. Narkar VA, Downes M, Yu RT, Embler E, Wang Y, Banayo E, Mihaylova MM,395Nelson MC, Zou Y, Juguilon H, Kang H, Shaw RJ, Evans RM. AMPK and PPARδ396agonists are exercise mimetics. Cell 134: 405-415, 2008.39717. Ohira M, Endo K, Saiki A, Miyashita Y, Terai K, Murano T, Watanabe F,398Tatsuno I, Shirai K. Atorvastatin and pitavastatin enhance lipoprotein lipase399production in L6 skeletal muscle cells through activation of adenosine400monophosphate-activated protein kinase. Metabolism 61: 1452-1460, 2012.40118. Ohira M, Miyashita Y, Murano T, Watanabe F, Shirai K. Metformin promotes402induction of lipoprotein lipase in skeletal muscle through activation of adenosine403monophosphate–activated protein kinase. Metabolism. 58:1408-1414,2009.40419. O’Neill HM. AMPK and exercise: glucose uptake and insulin sensitivity. Diabetes405Metab J 37:1-21, 201340620. Pilegaard H, Saltin B, Neufer D. Exercise induced transient transcriptional activation407of the PGC-1α gene in human skeletal muscle. J physiol 546: 851-858, 2003.40821. Ristow M, Zarse K, Oberbach A, Klöting N, Birringer M, Kiehntopf M, Stumvoll409M, Kahn CR, Blüher M. Antioxidants prevent health-promoting effects of physical410exercise in humans. Proc Natl Acad Sci U S A 106: 8665-8670, 2009.411 22. Seip RL, Angelopoulos TJ, Semenkovich CF. Exercise induces human lipoprotein412lipase gene expression in skeletal muscle but not adipose tissue. Am J Physiol413Endcrinol Metab 268: E229-E236, 1995.41423. Seip RL, Mair K, Cole TG, Semenkovich CF. Induction of human skeletal muscle415lipoprotein lipase gene expression by short-term exercise is transient. Am J Physiol416Endcrinol Metab 272: E255-E261, 1997.41724. Simsolo RB, Ong JM, Kern PA. The regulation of adipose tissue and muscle418lipoprotein lipase in runners by detraining. J Clin Invest 92: 2124-2130, 1993.41925. Takahashi Y, Ohoka N, Hayashi H, Sato R. TRB3 suppresses adipocyte420 differentiation by negatively regulating PPARγ transcriptional activity. J lipid Res 49:421880-892, 2008.42226. Tang QQ, Lane MD. Adipogenesis: From stem cell to adipocyte. Annu Rev Biochem42381:715–36, 2012.42427. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM. mPPARγ2:425Tissue-specific regulator of an adipocyte enhancer. Genes Dev 8: 1224-1234, 1994.42628. Wang H, Knaub LA, Jensen DR, Young Jung D, Hong EG, Ko HJ, Coates AM,427Goldberg IJ, de la Houssaye BA, Janssen RC, McCurdy CE, Rahman SM, Soo428Choi C, Shulman GI, Kim JK, Friedman JE, Eckel RH. Skeletal muscle-specific429deletion of lipoprotein lipase enhances insulin signaling in skeletal muscle but causes430insulin resistance in liver and other tissues. Diabetes. 58: 116-124, 2009.43129. Way JM, Harrington WW, Brown KK, Gottschalk WK, Sundseth SS, Mansfield432TA, Ramachandran RK, Willson TM, Kliewer SA. Comprehensive messenger433ribonucleic acid profiling reveals that peroxisome proliferatoractivated receptor434gamma activation has coordinate effects on gene expression in multiple435insulin-sensitive tissues. Endocrinology 142: 1269–1277. 2001.43630. Winder WW, Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of437AMP-activated protein kinase in muscle during exercise. Am J Physiol 270:438E299-E304, 1996.43931. Yashiro T, Nanmoku M, Shimizu M, Inoue J, Sato R.4405-Aminoimidazole-4-carboxamide ribonucleoside stabilizes low densitylipoprotein441receptor mRNA in hepatocytes via ERK-dependent HuR binding to an AU-rich442element. Atherosclerosis 226: 95-101, 2013.44332. Yoon M. The role of PPARα in lipid metabolism and obesity: Focusing on the effects444 of estrogen on PPARα actions. Pharmacol Res 60: 151-159, 2009.445446GRANTS447This work was supported by research grants from the Ministry of Education, Culture, Sports,448 Science and Technology of Japan.449450FIGURE LEGENDS451Fig. 1. Effects of exercise and AICAR treatment on gene expression in gastrocnemius muscle. A,452Exercise design was described in MATERIALS AND METHODS. After four weeks of exercise453training, gastrocnemius muscle was removed 18 h after the last exercise and PPARα, PPARδ,454PPARγ1, PGC-1α, LPL, CD36, and UCP3 mRNA levels were determined by quantitative455RT-PCR (n = 4). Relative mRNA levels were determined after normalization to 18S ribosomal456RNA levels. Relative mRNA levels in the control were set to 1. Results are means ± SD. *, P <4570.05, **, P < 0.01. Final body weights (in g); 29.0 ± 3.1 for controls and 26.8 ± 0.5 for458exercised mice. B, Mice were intraperitoneally treated with vehicle (saline) or AICAR459(200mg/kg) twice a day (at 10:00 and 20:00) for 3 days (400mg /kg/day). Whole gastrocnemius460muscle was removed 6 h after the last injection (at 10:00 on the day 4), and PPARα, PPARδ,461PPARγ1, PGC-1α, LPL, CD36, and UCP3 mRNA levels were determined by quantitative462RT-PCR (n = 5). Relative mRNA levels were determined after normalization to 18S ribosomal463RNA levels. Relative mRNA levels in the control were set to 1. Results are means ± SD. *, P <4640.05, **, P < 0.01.465466Fig. 2. AMPK activation induces increased PPARγ1 gene expression in C2C12 myotubes. A,467Phosphorylated (P-AMPK) or total AMPK (AMPK) and PPARγ1 (arrow) protein in AICAR (04682 mM for 12 h)-treated C2C12 myotubes were detected by western blotting (left). Western469blotting was carried out using C2C12 myotubes treated with 1 mM AICAR for the indicated470period of time (right). A stock AICAR solution (100 mM in distilled water) was added to the471medium. The mixed cell lysates (n = 3) were subjected to SDS-PAGE. B, PPARα, PPARδ,472PPARγ1, and PGC-1α mRNA levels in AICAR (1 mM) -treated C2C12 myotubes (0 h 15 h)473were determined by quantitative RT-PCR. Relative mRNA levels were determined after474normalization to 18S ribosomal RNA levels. Relative mRNA levels at time 0 were set to 1.475Results are means ± SD (n = 3). C, After incubation with 10 mM compound C (Com. C) for 1 h,476C2C12 myotubes were further incubated with or without 1 mM AICAR for 9 h. PPARγ1477 mRNA were determined by quantitative RT-PCR. Relative mRNA levels in the control were set478 to 1. Results are means ± SD (n = 3). Statistical comparisons were made by one-way analysis of479variance. Different superscript letters indicate that the means are significantly different (P <4800.01). D, C2C12 myotubes were incubated with AICAR (1 mM), metformin (2 mM), or H2O2481 (300 μM) either in the presence or absence of 10 mM compound C for 12 h, as described in Fig.4822C. The mixed cell lysates (n = 3) were subjected to SDS-PAGE and proteins were detected by483western blotting.484485Fig. 3. AMPK stabilizes PPARγ1 mRNA and results in a longer mRNA half-life in C2C12486myotubes. A, C2C12 myotubes were pre-treated with 5 μg/ml of actinomycin D for 30 min and487then further cultured with or without 1mM AICAR for 9 h. The mRNA level at time 0 was set at488100%. Results are means ± SD (n=3). **, P < 0.01 (vs. control). B, C2C12 myotubes were489pre-treated with 5 μg/ml of actinomycin D for 60 min and with 10μM compound C for the last49030 min and then further cultured with 1 mM AICAR for 9 h. The mRNA level at time 0 was set491at 100%. Percent remaining PPARγ1 mRNA is shown. Results are means ± SD (n = 3).492Statistical comparisons were made by one-way analysis of variance. Different superscript letters493indicate that the means are significantly different (P < 0.01).494495Fig. 4. PPARγ1 overexpression and a longer AICAR treatment (for 36 h) induces increased LPL496gene expression in C2C12 myotubes. A, C2C12 myoblasts were infected with a Flag-PPARγ1497lentivirus and allowed to differentiate into myotubes. Western blotting was performed using498anti-Flag, anti-PPARγ, anti-LPL, and anti-β-actin antibodies. B, MyoD, Myogenin, MyHC, LPL,499 CD36, UCP3, and PGC-1α mRNA levels in mock or Flag-PPARγ1 C2C12 myotubes were500determined by quantitative RT-PCR. Relative mRNA levels in mock C2C12 myotubes were set501to 1. Results are means ± SD (n = 3). **, P < 0.01. C, PPARγ1, LPL, UCP-3, CD36, and502PGC-1α mRNA levels in AICAR-treated C2C12 myotubes (0 to 36 h) were determined by503quantitative RT-PCR. Relative mRNA levels at time 0 were set to 1. Results are means ± SD (n504= 3). Statistical comparisons were made by one-way analysis of variance. Different superscript505letters indicate that the means are significantly different (P < 0.01).506507Fig. 5. PPARγ knockdown blocks the AMPK-induced increase in LPL mRNA. A, C2C12508myoblasts were infected with an sh control or an sh PPARγ lentivirus and allowed to509differentiate into myotubes. Phosphorylated (P-AMPK) or total AMPK (AMPK) and PPARγ1510 (arrow) protein in AICAR-treated or -untreated myotubes (for 12 h) were detected by western511blotting. B, MyoD, Myogenin, and MyHC mRNA levels in control or PPARγ-knockdowned512myotubes were determined by quantitative RT-PCR. Relative mRNA levels in control C2C12513myotubes were set to 1. Results are means ± SD (n = 3). C, C2C12 myotubes infected with an514 sh control or an sh PPARγ lentivirus were cultured with AICAR (1 mM) for 36 h. LPL, CD36,515UCP3, and PGC-1α mRNA levels were determined by quantitative RT-PCR. Relative mRNA516levels in control C2C12 myotubes without AICAR treatment were set to 1. Results are means ±517SD (n = 3). Statistical analysis used two-way analysis of variance with Tukey post-hoc518comparisons. *, P<0.05 **, P <0.01 compared with the baseline(within a knock down group) #,519P <0.05 ##, P <0.01 compared with the sh control group(between a knock down group). D,520C2C12 myotubes were incubated with AICAR (1 mM) with 512 or without GW9662 (20 μM)521for 36 h. LPL, CD36, and UCP3 mRNA levels were determined by quantitative RT-PCR.522Results are means ± SD (n = 3). Statistical analysis used two-way analysis of variance with523Tukey post-hoc comparisons. *, P <0.05 **, P <0.01 compared with the baseline (within a524DMSO or GW9662 group) #, P <0.05 ##, P <0.01 compared with a DMSO group (between a525DMSO and GW9662 group).526527 Fig. 6. Summary and working hypothesis of the effect of exercise and AMPK activation on LPL528gene expression in skeletal muscle. Exercise and AICAR treatment phosphorylate and activate529 AMPK in skeletal muscle. The exercise-mediated activation of AMPK is likely mediated via530either the direct or the ROS-induced decrease in ATP levels. This leads to stabilization of531PPARγ1 mRNA and increases PGC-1α mRNA levels. Finally, LPL gene expression is increased532 mostly by PPARγ1 and UCP-3 gene expression is regulated by the combination of PPARγ1 and533PGC-1α.534