Ammonia excretion in the Atlantic hagfish

32 33 Hagfishes are the most ancient of the extant craniates, and demonstrate a 34 high tolerance for a number of unfavorable environmental conditions including 35 elevated ammonia. Proposed mechanisms of ammonia excretion in aquatic 36 organisms include vesicular NH4+ transport and release by exocytosis in marine 37 crabs, and passive NH3 diffusion, active NH4+ transport and paracellular leakage of 38 NH3 or NH4+ across the gills of fishes. Recently, an emerging paradigm suggests that 39 Rhesus glycoproteins play a vital role in ammonia transport in both aquatic 40 invertebrates and vertebrates. This study has identified an Rh glycoprotein ortholog 41 from the gills of Atlantic hagfish. The hagfish Rhcg shares a 56-60% amino acid 42 identity to other vertebrate Rhcg cDNAs. Sequence information was used to 43 produce an anti-hagfish Rhcg (hRhcg) antibody. We have used hRhcg to localize 44 protein expression to epithelial cells of the gill and the skin. In addition, we have 45 quantified hRhcg expression following exposure to elevated plasma ammonia levels. 46 Animals exposed to a 3mmol kg-1 NH4Cl load resulted in significantly elevated 47 plasma ammonia concentrations in comparison to controls for up to 4 hours post 48 injection. This correlated with net ammonia excretion rates that were also 49 significantly elevated for up to 4 hr post injection. Rhcg mRNA expression in both 50 the gill and skin were significantly elevated by 15 min and 1 hr respectively and 51 hRhcg protein expression in gills was significantly elevated at 2, 4, 8 hr post 52 injection. These results demonstrate a potential role for Rhcg in the excretion of 53 ammonia in the Atlantic hagfish. 54 55 Introduction 56 In most fishes the major end product of nitrogen metabolism is ammonia, 57 which is toxic and must be excreted to avoid accumulation. More than 80% of 58 ammonia in teleost fishes is excreted across the branchial epithelium of the gill (42). 59 Recently there has been a resurgence in exploration of the mechanisms associated 60 with ammonia excretion in fishes, with most studies focusing on freshwater teleosts 61 (19, 21-24), elasmobranchs (20) and most recently on the Pacific hagfish (1). The modern 62 hagfishes are the sole survivors of the jawless stage in vertebrate evolution; they are 63 considered the most ancient of the agnatha, having diverged from the main 64 vertebrate lineage more than 500 million years ago (14). Hagfishes are exclusively 65 osmoconforming marine animals with most living at considerable depths, and are 66 the only living vertebrates to maintain their plasma NaCl concentration almost iso67 osmotic to that of seawater (10). The unique osmoregulatory characteristics imply 68 that hagfishes have always inhabited a marine environment making them a unique 69 model to explore ammonia excretion (26, 27). 70 Hagfishes feed on dead and decaying carcasses located on the sea floor, often 71 invading the carcass via an orifice and eating their way out. In such circumstances 72 the hagfish can be exposed to extreme conditions including; high CO2, low O2, low 73 pH and elevated ammonia concentrations (1, 38) . Yet to date we know very little 74 about how these animals produce or rid themselves of nitrogenous wastes. A 75 previous study on Pacific hagfish demonstrated that in the laboratory, these animals 76 excrete nitrogenous waste primarily in the form of ammonia with only 6.9% 77 excreted in the form of urea (35). To date there has been very little attention given to 78 the mechanisms associated with ionoand osmoregulation in hagfishes. One 79 possible explanation for this is that it has long been thought that if an organism 80 ionoosmoconforms to its environment it might not require highly developed and 81 energetically expensive transport mechanisms (5). However, the hagfish gills are 82 populated by numerous mitochondrial rich cells (MRCs); the cells that associated 83 with Na+ uptake and Clexcretion in marine teleosts. The hagfish MRCs occur singly 84 and are tightly bordered by pavement cells and there is an absence of the leaky 85 paracellular junction that exists in the branchial epithelium of marine teleosts. 86 However to the best of our knowledge there is no physiological data on the 87 transepithelial conductance of hagfish gill epithelium. The hagfish branchial 88 epithelium has been shown to express a number of proteins associated with 89 ammonia transport in both invertebrates and vertebrates; Na+/K+-ATPase, V-Type 90 H+-ATPase, carbonic anhydrase (CA) and Na+/H+ exchanger isoforms (NHE) (3, 6, 33, 91 34). While the hagfishes may not use these transporters to regulate Na+ and Cl-, they 92 have been shown to play a role in the maintenance of acid/base homeostasis (6). The 93 presence of a functional Na+/H+ exchanger in the hagfish gill was first suggested by 94 Evans as a mechanism associated with acid/base regulation in a marine 95 environment (7). This suggestion was further supported by the demonstration of a 96 significant increase in hagfish gill NHE mRNA expression following the induction of 97 metabolic acidosis (6). An alternate role for the NHE would be to act as a Na+/NH4+ 98 exchanger, however, Evans (1984) (7) found no evidence for the presence of 99 Na+/NH4+ exchange in the Atlantic hagfish. This finding along with recent evidence 100 presented for Pacific hagfish suggest the hagfishes ability to excrete ammonia 101 following a perturbation may be via Rh glycoproteins (1). 102 The Rh glycoproteins are a family of transmembrane proteins that were first 103 identified in erythroid cells and were mainly studied for their importance to human 104 blood transfusion immunocompatibility. The broader Rh protein family is 105 comprised of the non-glycosylated proteins, the Rh-30, and the glycosylated Rh-50 106 proteins that are implicated in ammonia transport. On the molecular level these 107 proteins are related to the MEP/Amt (Methyl ammonium permease/Ammonia 108 transport) proteins, and are present in the kidney, liver, skin and testis of mammals, 109 all possible sites of ammonia excretion. A recent phylogentic study found that Rh 110 and Amt proteins were found together in a wide range of organisms from eukaryotic 111 microbes to invertebrates; however, all vertebrates examined to date whilst 112 possessing multiple copies of Rh genes lacked Amt genes (11). 113 The presence of Rh proteins in a range of organisms suggests a long 114 evolutionary history. Phylogenetic analysis has given some insight into the origin 115 and gene duplications of Rh genes. In aquatic crustaceans only one Rh isoform has 116 been identified and has been grouped into the more primitive cluster Rhp1 (11, 37). 117 Some vertebrates possess additional paralogues; teleost fishes have two Rhcg genes 118 and a novel gene defined as Rhp2. It is thought that Rhp2 is probably the most 119 ancient of the Rh genes in vertebrates as it is specifically expressed in the gut and in 120 the shark kidney and, with the exception of Danio rerio, it lacks introns (20). 121 Additionally genome mining has identified the Rhp1 gene, which is present in a 122 number of invertebrates and was initially assumed to be the most ancient cluster of 123 the eukaryotes. It has 5 introns in all species examined, however, to date no Rhp1 124 mRNA expression has been identified in vertebrate tissues (12). The identification of 125 Rhag, Rhbg, Rhcg and Rhp2, in the elasmobranchs all of which are also seen in 126 advanced vertebrates suggests that these genes were present prior to the 127 divergence of the elasmobranchs and teleost fishes. 128 Nakada et al. (19) presented evidence suggesting that the pufferfish (Takifugu 129 rubripes) utilizes multiple Rh glycoproteins for ammonia excretion. The localization 130 of Rh glycoprotein mRNA and protein expression in the gill lamellae allowed the 131 development of a working model for Rh glycoprotein mediated ammonia excretion 132 in pufferfish. The evidence suggested that Rhag was located both apically and 133 basolaterally on pillar cells, Rhbg was localized to the basolateral membrane of 134 pavement cells, with Rhcg2 localized to the apical membrane. Finally Rhcg1 was 135 localized to the apical membrane of mitochondrion rich cells. A number of 136 subsequent studies have identified Rh glycoprotein orthologs in multiple marine 137 fish species (20, 28). In a review, Weihrauch et al. (38) presented two working models 138 for ammonia excretion across the branchial epithelium of marine fishes; one 139 associated with pavement cells and the other with mitochondrion rich cells MRCs. 140 The pavement cells model involves basolaterally located Rhbg and apically located 141 Rhcg2 as proposed by Nakada et al. (2007b), but adds that significant diffusion of 142 NH3 and NH4+ likely occurs across the shallow paracellular junction of gill epithelial 143 cells in marine fishes. Weihrauch. et al. (38) suggested that as pavement cells 144 comprise the majority (greater than 90%) of the surface area of the marine fish gill, 145 they most likely provide the dominant route of branchial ammonia excretion. 146 Alternately, the proposed MRC model is primarily focused on the transport of NH4+ 147 into the MRCs via basolaterally located NKA and NKCC and excreted as NH4+ 148 substituted for H+ as the substrate of apically located Na+/H+-exchanger (NHE-2) or 149 as NH3 by Rhcg1 (38). The localization of Rhcg variants 1 & 2 to the apical membrane 150 of branchial epithelial cells, suggests their possible involvement in facilitating the 151 outward diffusion of NH3 from the branchial epithelium to the water. A recent study 152 on the Pacific hagfish, utilized heterologous antibodies raised against zebrafish Rh 153 orthologs and broadly suggested that these proteins present a possible route for 154 ammonia excretion in hagfish (1). That study set the stage for the current work, as 155 the purpose of the present study was to focus specifically on the apical Rhcg as a 156 possible excretion route for nitrogenous waste in the Atlantic hagfish. We 157 hypothesized that if Rhcg was involved in ammonia excretion in Atlantic hagfish, 158 that following the induction of elevated plasma ammonia levels; there should be a 159 corresponding increase in gill Rhcg mRNA and protein expression. This study used 160 RT-PCR to identify a single Rhcg ortholog from hagfish tissues from which we have 161 produced and verified the first hagfish specific anti-Rhcg antibody. This study 162 utilized these tools to determine Rhcg localization, mRNA and protein expression 163 following ammonia loading in the Atlantic hagfish. 164 165 Materials and Methods 166 Animals 167 Atlantic hagfish (Myxine glutinosa)(n=80) (40-115g) were caught off the coast of 168 Maine by commercial fishermen and transferred to large (20,000 l) aquaria at the 169 Mount Desert Island Biological Laboratory (MDIBL). Seawater (12-15 °C) was 170 pumped continuously from Frenchman Bay into the aquaria via the MDIBL running 171 seawater system. All animals were held without feeding for 2 weeks prior to 172 commencement and during experimentation. IACUC committees of MDIBL & 173 Appalachian State University approved the animal experimental procedures. In all 174 terminal procedures, hagfish were anaesthetized using 800 mg l-1 MS-222 (Argent 175 Labs, Redmond, WA) prior to decapitation. 176 Molecular cloning and sequence analysis 177 Total RNA was prepared from tissues homogenized in Tri-Reagent (Molecular 178 Research Center, Cincinnati, OH), cDNA was generated in a reverse transcription 179 reaction (SuperScript II; Invitrogen, Carlsbad, CA) and a PCR product was obtained 180 using a degenerate primer pair (Table 1) aimed at conserved regions based on other 181 vertebrate sequences. A BLAST search indicated that the resulting sequence of the 182 ~700 bp RT-PCR fragment was most homologous to Rhcg and a series of specific 183 nested primers (Table 1) were then designed for use in 3’ & 5” RACE (Clontech, 184 Mountain View, CA). RACE products were subcloned into a pGem vector (Promega, 185 Madison, WI) and sequenced at Genome Quebec (Montreal, Quebec). An open 186 reading frame (ORF) was constructed from overlapping fragments MacVector 187 (MacVector, Inc. Cary, NC). 188 The predicted amino acid sequence from the hagfish Rhcg ORF was aligned with 189 mammalian and fish Rh glycoprotein sequences downloaded from NCBI. 190 Phylogenetic tree was constructed (MacVector) using the neighbor joining method 191 with Poisson correction and calculation of absolute differences and bootstrap 192 confidence estimates (1000 replications). 193 194 In situ hybridization 195 RNA probes 196 A 252bp cDNA fragment of Hagfish Rhcg (hRhcg) was inserted into RNA expression 197 vector pGem TEasy (Promega). RNA expression vector was then linearized by 198 restriction enzymes SacII and SpeI to allow in vitro run off synthesis of both sense 199 and antisense RNA probes. Generation of both sense and antisense digoxigenin 200 (DIG)-labeled RNA probes was accomplished using in vitro transcription as per the 201 DIG-RNA labeling kit (Roche Applied Science, Indianapolis, IN). 202 Tissue sections were post-fixed in 4% paraformaldehyde in DEPC treated 203 phosphate-buffered saline (PBS) then rinsed in PBS with 0.1% DEPC followed by 5 x 204 SSC (NaCl/Na citrate). Sections were then placed into prehybridization buffer (4 x 205 SSC containing 50% (v/v) deionized formamide) at 62°C for 2 hours. 206 Prehybridization buffer was replaced with hybidization buffer (40% deionized 207 formamide, 10% dextran sulphate, 1 x Denhardts solution, 4 x SSC, 10mM 208 dithiothreitol (DTT) 1mg/ml yeast t-RNA, 1mg/ml salmon sperm DNA) containing 209 10ng/ml labeled sense or anti-sense mRNA (generated from the PCR product as 210 above) and incubated in a humid chamber overnight at 62°C. Tissue sections were 211 immersed in 2 x SSC in a shaking water bath at 37°C, then 1 x SSC. Sections were 212 then equilibrated in washing buffer (Roche Applied Science, Indianapolis, IN) for 5 213 min at room temperature followed by an overnight incubation in anti-DIG antibody 214 diluted 1:5000 in blocking reagent at room temperature. Sections were washed in 215 washing buffer (BM) then equilibrated in detection buffer. Labeled hRhcg mRNA 216 was visualized with NBT/BCIP and the reaction was stopped with TE pH 8. 217 218 Ammonia injection and water/tissue sampling 219 We chose to follow a similar ammonia loading protocol as established by 220 Braun & Perry(1), where to achieve a circulating plasma ammonia concentrations of 221 10mM NH4Cl, they assumed that the animals extracellular volume was 30% of the 222 mass, we therefore calculated the volume of 100mM NH4Cl (diluted in buffered 223 seawater pH 7.8) or a sham (buffered seawater only) that resulted a 3mmol kg-1 224 infusion of ammonia. Animals were anaesthetized and injections made into the 225 posterior sinus. 226 The animals were then returned to the aerated individual chambers and 227 water flow was ceased and 2.5 ml water samples were taken at time 0,0.25, 0.5 1, 2, 228 4, 6, 8, 12, and 24 hours and frozen (-20 ̊C). A parallel series of experiments was 229 conducted using an identical protocol to the above, and terminal tissue and blood 230 samples were taken at time 0, 0.25, 0.5, 1, 2, 4, 6, 8, 12, and 24 hours. Animals were 231 sacrificed as previously mentioned and blood, gills and skin were sampled. The 232 blood was immediately centrifuged and plasma snap-frozen in liquid nitrogen for 233 ammonia assay. Harvested tissues were preserved in 4% paraformaldehyde for 234 immunohistochemistry or were snap frozen in liquid nitrogen and stored at -80°C. 235 236 Water analysis 237 Water samples were analyzed in triplicate to determine total Ammonia 238 (TAmm) using the phenol-hypochlorite method (36). Net flux rates (μmol kg-1 h-1) of 239 TAmm were calculated as 240 JAmm = ([TAmm]i – [TAmm]f) x V/(Δt x M) 241 Where [TAmm]I and [TAmm]f are initial and the final TAmm concentration (μmol l-1) in 242 the water, V= volume of water (l) in flux chamber, Δt is the time (h) elapsed in the 243 flux period and M= fish mass (kg). A positive JAmm indicates net excretion and 244 negative value indicated net uptake. 245 246 Plasma Ammonia profile 247 Plasma samples were deproteinized in two volumes of 8% perchloric acid, 248 vortexed and centrifuged at 16,000g (4°C). The supernatant was neutralized with 249 saturated KHCO3 and centrifuged at 16,000g (4°C). Using the final deproteinized 250 supernatant, ammonia concentrations (μmol l-1) were measured in triplicate using a 251 micro-plate modification of the L-glutamate dehydrogenase assay (Sigma AA0100, 252 St. Louis, MO). The absorbance of each sample was measured at 340 nm following 253 incubation with the ammonia assay reagent and again after the addition of L254 glutamate dehydrogenase enzyme with a VersaMAX plate reader (Molecular 255 Devices, Sunnyvale, CA). 256 257 Real-time quantitative PCR (qPCR) 258 Relative expression of Rhcg mRNA was quantified in gill and skin tissues 259 using homologous primers (Table 1). In both gill and skin the ribosomal protein 18S 260 was used as an endogenous control. Expression of mRNA was only quantified for 261 individuals in experiments lasting up to 8 hours after injection. Each sample was 262 analyzed in triplicate using 25 ng of template cDNA, 70 nmol of each forward and 263 each reverse primer, 0.5 μl of ROX reference dye diluted 1:10 and SYBR® GreenER 264 SuperMix-UDG (Invitrogen) in a total volume of 25 μl. Amplification of the desired 265 product was confirmed using melt curve analysis. Relative mRNA expression in 266 both gill and skin tissues from ammonia-injected individuals was normalized to that 267 of the saline-injected individuals from the same experiments (time durations). 268 Threshold cycle (Ct) was determined for each sample using ABI Systems 7500 269 software. Analysis of relative expression used the 2(-ΔΔCt) method (25). 270 AntibodyProduction 271 Myxine glutinosa-specific, rabbit polyclonal antibody was raised against 272 amino acid 419-434 specific to the hagfish Rhcg (hRhcg) sequence 273 (5’CYEDRAYWEVPEEEVTY-3’). The antibodies were produced in house at 274 Appalachian State University. Rabbits were initially inoculated intramuscularly with 275 1.5mg of keyhole limpet hemocyanin (KLH) conjugated peptide (BioSource, 276 Lewisville, TX) emulsified in 0.5ml Freund’s complete adjuvant (Sigma-Aldrich). 277 Animals received 3 booster injections of conjugated peptide (0.75-1mg emulsified in 278 Freund’s incomplete adjuvant) 3 weeks apart. Animals were bled prior to each 279 booster injection and antibody titers were determined by enzyme-linked 280 immunosorbant assay. 281 Western blotting 282 Hagfish gill and skin were weighed and placed in ice-cold homogenization 283 buffer (250 mM sucrose, 1 mM EDTA, 30 mM Tris, 100μg/ml PMSF and 5 mg/ml 284 protease inhibitor cocktail). Tissues were placed in buffer (0.18g Tris-base, 4.28g 285 sucrose, 0.5ml 100mM EDTA, pH 7.8) and homogenized in polypropylene tubes on 286 ice. The homogenate was centrifuged at 13,000 x g at 4 ̊C to remove debris. The 287 supernatant was decanted and its total protein concentration was quantified using a 288 BCA (bicinchoninic acid) protein assay (Thermo Scientific, Rockford, IL). Protein 289 samples (25μg) were loaded in Criterion –TGX -20% acrylamide gels (Bio-Rad, 290 Hercules, CA) and separated by SDS-PAGE (sodium dodecyl sulfate, polyacrylamide 291 gel electrophoresis). Separated proteins were transferred on to nitrocellulose 292 membranes (Millipore, Billerica, MA). Membranes were blocked overnight at 4°C in 293 5% blotto (5% nonfat dry milk powder in 0.1M Tris-buffered saline with 0.2% 294 Tween-20). Membranes were then incubated in 5% blotto (negative control), hRhcg 295 antibody (1:5000) in 5% blotto (positive control), or hRhcg antibody preabsorbed 296 1:10 and 1:20 with purified hagfish Rhcg peptide (1:5000) in 5% blotto overnight at 297 room temperature. Following three washes (0.1M Tris-buffered saline with 0.2% 298 Tween-20 (TBST)), membranes were incubated with HRP (horseradish peroxidase)299 conjugated goat anti-rabbit antibody (1:10,000) and Precision Protein StrepTactin300 HRP conjugate (Bio-Rad, Hercules, California) in TBST at room temperature for one 301 hour. Unbound secondary antibodies were removed with three additional washes in 302 TBST and a final wash in TBS. Immunoblotted membranes were then developed 303 using an enhanced chemiluminescence system (Bio-Rad). Visualization of the blots 304 was done using Bio-Rad Chemi-doc system and densitometry analysis was 305 conducted using Image analysis software (Bio-Rad). 306 Immunohistochemistry 307 Gill filaments from hagfish were removed and placed in fixative (4% 308 paraformaldehyde in 10 mmol l-1 phosphate-buffered saline, pH 7.4) for 24 h at 4°C. 309 After fixation, filaments were rinsed in three changes of 1X PBS and paraffin 310 processed. Tissues were sectioned at 7 μm on a Leitz microtome and mounted on 311 positively charged slides (Fisher Scientific). Sections were blocked (5% normal goat 312 serum, and 0.1% Tween-20 in PBS at pH 7.4), then incubated with primary 313 antibody, diluted in block: hRhcg (1/500) overnight at room temperature, in a 314 humidified chamber. Unbound primary antibody was removed by washing in PBS. 315 Sections were then incubated with Alexa Fluor® goat anti-rabbit 488 (Molecular 316 probes, Grand Island, NY) secondary antibody diluted in block for 1 hr at RT. After 317 rinsing for 15 min in PBS, sections were incubated for 30 min with NucRed® Dead 318 647 ReadyProbes® reagent (Molecular probes, Grand Island, NY) and coverslipped 319 using Prolong® gold anti-fade reagent (Invitrogen, Grand Island, NY) and visualized 320 using a Zeiss LSM510 Confocal Microscope. 321 Negative staining controls for hRhcg were processed as above, in the absence 322 of primary antibody and using preabsorbed antibody incubations. In preabsorbed 323 controls, hRhcg was diluted to 1.25 μg/ml in block that also contained 2.5 μg/ml of 324 hRhcg antigen. The antibody and peptide mixture was allowed to incubate at RT for 325 30 min before addition to tissue sections. 326 327 Statistical Analysis 328 Data are presented as mean + SEM (standard error of the mean). Hypotheses 329 were tested using a one way repeated measures analysis of variance (ANOVA, 330 α=0.05) followed by Fisher’s Least Significant difference Post hoc test for ammonia 331 concentrations, excretion rates, and comparisons of mRNA and protein expression 332 over time. Student’s two-sample t-test (P=0.05) was used as needed for the simple 333 comparison of two means. 334 335 RESULTS 336 Molecular properties of hagfish Rhcg 337 The complete sequence obtained by 5’ and 3’ RACE was deposited into the 338 GenBankTM database (Accession # GU733440). The isolated cDNA was 1461 339 nucleotides in length encoding for a sequence of 486 amino acid residues. Like the 340 other members of the Rh glycoprotein family the protein contains a putative N341 glycosylation site (ASN-239) that appears to be highly conserved amongst all 342 members of this gene family. The deduced amino acid sequence of shares high 343 identity (64%) with other known vertebrate Rhcg homologs indicating that the 344 cDNA encodes a hagfish Rhcg (Fig 1). 345 346 In situ hybridization and immunohistochemical localization of hRhcg 347 Sections incubated in the antisense hagfish Rhcg RNA probe labeled specific 348 epithelial cells localized to the basal aspect of the filament epithelium along the 349 region of the filament closest to the blood margin (Fig 2A). Sense negative controls 350 were devoid of staining (Fig 2A insert). The hagfish specific Rhcg antibody labeled a 351 similar population of epithelial cells localized to the basal aspect of the branchial 352 epithelium, specifically hRhcg (green) was localized to epithelial cells along the 353 innermost layer of the epithelium closest to the blood vessel margin (Fig 2B, C). No 354 immunoreactivity was present in the negative controls (not shown). An interesting 355 finding was that hRhcg immunoreactivity was also present in the skin of the hagfish, 356 with hRhcg immunoreactive cells (red) localized to regions surrounding the mucous 357 glands (Fig 3A,B). No immunoreactivity was present in negative controls (not 358 shown). 359 Water Ammonia Profile 360 Individuals injected with 3mmol kg-1 NH4Cl exhibited a significantly 361 increased (P= <0.05) rate of ammonia efflux (relative to sham-injected individuals) 362 up to 4 hours post-injection (Fig 4). There were no significant differences in 363 ammonia efflux between sham and ammonia-injected groups throughout all 364 subsequent time-points. 365 366 Plasma Ammonia Profile 367 The concentration of total ammonia detected in the plasma of ammonia368 injected hagfish was significantly higher than in sham-injected individuals at all 369 times points prior to 8 hours post-injection (Fig 5). Plasma ammonia 370 concentrations were most elevated at 0.25 hours following injection, but generally 371 decreased over time relative to concentrations observed in saline-injected 372 individuals. 373 374 Relative Quantification of hRhcg mRNA 375 The relative expression of Rhcg mRNA was significantly altered in the gill 376 tissues of ammonia-injected individuals in comparison to sham at all time points 377 (Fig 6a). Hagfish gill Rhcg mRNA was significantly elevated in ammonia injected 378 animals relative to controls at 0.25, 0.5 hour time periods (P= <0.05). In the time 379 periods from 1 hour post-injection onward to 12 hours, Rhcg mRNA expression in 380 ammonia-injected individuals was significantly lower that of saline-injected 381 individuals. Relative mRNA expression of hRhcg mRNA in skin samples 382 demonstrated a significant increase in Rhcg mRNA expression in animals at 0.5 383 hours post ammonia load in comparison to sham (P=0.002). This was followed by a 384 reduced Rhcg mRNA expression at all time points from 1 hour onward (Fig 6b). 385 386 Western Blot analysis of hRhcg expression in gill 387 Western blots on gill tissue using the homologous hRhcg antibody 388 demonstrated a distinct immunoreactive protein at 48kDa (Fig 7a). In negative 389 controls blots incubated in antibody preabsobed with peptide (Fig. 7b lanes 1-3) 390 and in blots incubated in pre-immune serum (Fig 7 lane 4) the 48 kDa band is 391 clearly absent. Protein concentration for each gill sample was quantified based upon 392 a standardized load of 25ug of total protein loaded in to each well of each gel. The 393 gill 48 kDa hRhcg immunoreactive protein demonstrated a significant increase in 394 expression in comparison to controls at 2, 4 and 8 hours post ammonia injection 395 (Fig 7c). 396 397 Discussion 398 There have been previous studies demonstrating the hagfish’s ability to 399 excrete ammonia(1, 7, 18), the current study is the first to identify and quantify Rhcg 400 mRNA and protein expression in epithelial tissues of the Atlantic hagfish (Myxine 401 glutinosa) following an ammonia load. This study has demonstrated that following 402 an artificial elevation in plasma ammonia concentrations Atlantic hagfish respond 403 through increased ammonia efflux which is correlated to an initial significant 404 elevation in both gill and skin hRhcg mRNA expression and a later up regulation of 405 hRhcg protein expression in the gill which overlapped slightly with the elevated 406 excretion period. Immunohistochemistry more specifically demonstrated that 407 hRhcg immunoreactive cells were indeed present in both the branchial epithelium 408 as well as in the dermis of the skin. 409 Phylogenetic reconstruction (Fig 1) of Atlantic hagfish Rhcg lineages relative 410 to Rhcg, Rhbg, Rhp2 and Rhp1 isoforms in a number of other organisms 411 demonstrates that hagfish Rhcg forms a clade with other vertebrate Rhcg isoforms. 412 A recent study examining the phylogenetic relationship of cyclostome Rh isoforms 413 suggested that the our hagfish Rhcg and lamprey Rhcg-like genes are more than 414 likely orthologs of gnathostome Rh (32) . While the aforementioned study did not 415 examine the primitive isoform Rhp2, although present in a teleost and 416 elasmobranch fishes, the Rhp2 appears to be ancestral to the hagfish Rhcg, this 417 result is to be expected given the results of Huang & Peng (11). 418 Prior to this study, it was known that Atlantic hagfish had the ability to 419 excrete ammonia(7, 18, 35 ). However, little was known about the mechanisms by 420 which this excretion was achieved. Given this species known burrowing and feeding 421 behaviors (17) the ability to rapidly excrete ammonia in less than favorable 422 conditions is advantageous and thus not surprising. Atlantic hagfish spend the 423 majority of their life burrowed in hypoxic and at times often anoxic ocean-floor 424 substrate and may remain there for days at a time (31). Although gut-content 425 analysis has shown that Atlantic hagfish may feed primarily on shrimp and other 426 invertebrates (29) they are known to opportunistically feed on the carcasses of 427 whales and teleost fishes where they have been shown to enter through and orifice 428 to feed on the rotting flesh from the inside out (31) . The invasion of carcasses to feed 429 could result in a reduction in adequate gas exchange and consequently result in an 430 acid-base imbalance (2). Conditions within a carcass likely include low O2, high CO2, 431 low pH, and high environmental ammonia (5, 38). Hagfish have developed multiple 432 physiological adaptations to combat extended exposure to hypoxic/anoxic 433 conditions, including reduced metabolic rates and energetic requirements, as well 434 as cutaneous respiration (15). It has been suggested that fishes that are tolerant of 435 hypoxia are often ammonia tolerant, as the result of the common mechanism of 436 neurotoxicity that is shared between hypoxia and ammonia (glutamine 437 excitotoxicity) (41). Pacific hagfish tolerate both high internal ammonia loads and 438 high environmental ammonia concentrations, surviving more than 72 hours of 439 exposure to high environmental ammonia of 100 mM NH4Cl (1). While in the current 440 study Atlantic hagfish were not exposed to high environmental ammonia they were 441 shown to be tolerant of a 3mmol kg-1 infusion of ammonia as NH4Cl, eliminating the 442 internal ammonia load and surviving for 24 hours post-infusion. 443 Following injection hagfish plasma ammonia concentration was significantly 444 elevated to 1200 μmol l-1 within 15 minutes and remained significantly elevated for 445 up to 4 hours post injection (Fig 5.). Increased plasma ammonia concentrations 446 corresponded with significantly increased rates of ammonia efflux over the same 447 time period (Fig 4), suggesting that Atlantic hagfish are either readily equipped for 448 remarkable ammonia excretion (more the 10X that of sham-injected fish) or that the 449 necessary protein components may be preassembled and stored in intracellular 450 vesicles to facilitate a rapid response to a stimulus such as feeding resulting in an 451 increased ability to handle the associated ammonia load. This increase in excretion 452 rate has been also reported in a previous study in Atlantic hagfish in which 453 ammonia excretion rates of nearly 1400 μmol N kg-1 h-1 were observed in the first 454 0.5 hour following 4 mmol kg-1 infusion of ammonia as (NH4)2SO4, this was a 7-fold 455 increase over resting ammonia excretion rates(18). 456 Ammonia excretion rates in ammonia-injected hagfish gradually decreased 457 to levels similar to sham-injected animals by 6 hours post-injection. The maximum 458 accumulated total ammonia concentration in the environmental water of ammonia459 injected hagfish, occurring at 24 hours post-injection was 2.2 mmol kg-1, which was 460 74% of the total 3 mmol kg-1 load introduced by injection. The net remaining 0.8 461 mmol kg-1 of total ammonia was not excreted into the environmental water, 462 although the remaining ammonia was apparently eliminated from the plasma. There 463 are several explanations that may account for this non-excreted fraction of the 464 ammonia load: (1) In the sea lamprey (Petromyzon marinus), it has been suggested 465 that in lamprey the muscle may serve as a reservoir to reduce circulating plasma 466 ammonia concentrations (40). It is possible that a similar mechanism could be 467 present in the Atlantic hagfish, testing of this hypothesis requires further 468 investigation. (2) Alternately, the remaining ammonia may be metabolized into 469 amino acids/proteins or urea. Braun and Perry demonstrated that in Pacific hagfish 470 injected with NH4Cl there was a delayed response in urea excretion with a 471 significant increase in the excretion of urea seen at 6-9 hours post injection reported 472 to be approximately 0.08 μmol N g-1 h-1 (1). However, while it is not known if Atlantic 473 hagfish possess the enzymes associated with the metabolism of ammonia into urea, 474 it is possible that the remaining ammonia load in this study could have been 475 converted to urea and excreted. 476 Our results have demonstrated an increase in Rhcg mRNA expression in 477 ammonia-loaded fish prior to 1 hour post-injection. This is not necessarily 478 surprising, as elevated plasma ammonia may serve as a stimulus for the increased 479 production of Rh glycoproteins and may suggest that the expression of Rh 480 glycoprotein mRNA is tightly regulated in response to ammonia infusion. Evidence 481 presented in teleost fishes supports the upregulation of branchial Rhcg1, Rhcg2, and 482 Rhbg mRNA expression in response to ammonia infusion (22). However, those 483 authors suggest that a combination of elevated plasma ammonia and a temporary 484 pulse of cortisol may be key to Rh mRNA regulation. Atlantic hagfish plasma cortisol 485 levels were not assessed in the current study due to a long-standing controversy 486 regarding the identity of an active corticosteroid in hagfish (39). However, Atlantic 487 hagfish gill and skin Rhcg mRNA expression was clearly diminished in later time 488 points. The gills demonstrated significantly down regulated mRNA expression at all 489 subsequent time-points in ammonia-injected hagfish despite elevated plasma 490 ammonia concentrations and ammonia excretion rates up to 4 hours following 491 ammonia-injection (Fig 6a,b). This pattern of regulation suggests an immediate 492 response to elevated plasma ammonia that is subsequently altered in response to 493 additional factors. Among the possible stimuli inducing the down regulation of gill 494 and skin Rhcg mRNA expression is the concentration of ammonia in the 495 environmental water (24). It has been suggested that Rh glycoproteins can transport 496 ammonia bi-directionally (16) and thus could potentially allow inward flux of 497 ammonia the result of a reversed diffusion gradient caused by high environmental 498 ammonia. This hypothesis was evaluated in marine pufferfish (Takifugu rubripes) 499 exposed to 1 mmol l-1 environmental ammonia demonstrated a significant down 500 regulation of Rhag mRNA expression after 6 hours and down regulation of Rhbg 501 mRNAs after 24 hours of exposure (24). However, no protein quantification of the Rh 502 glycoproteins was conducted, due to the presence of multiple non-specific bands in 503 western blot analysis. Interestingly, Rhcg1 mRNA expression, as well as that of 504 NKCC1, NKA, NHE3, and H+-ATPase, was up regulated in response to high 505 environmental ammonia. This led the authors to propose that, following prolonged 506 high environmental ammonia exposure, ammonia transport may shift from a 507 dependence on passive transport via Rh glycoproteins to active transport by the 508 recruitment of ion-transporters in MRCs (24). It is conceivable that accumulated 509 environmental ammonia concentrations could stimulate a subsequent down 510 regulation of gill and skin Rhcg mRNA expression in ammonia-injected hagfish, even 511 while plasma ammonia concentrations and ammonia excretion rates both remain 512 elevated above sham-injected levels as a protective mechanism to reduce the 513 backflow of ammonia from the environment. 514 Quantification of protein expression from individuals in this study was 515 conducted using the hagfish specific Rhcg antibody (hRhcg) demonstrated that 516 hRhcg protein expression in the gill was significantly elevated (P<0.05) by 2 hours 517 post-injection and continued to rise through 8 hours post-injection in ammonia518 injected hagfish (Fig 7c). In ammonia-injected hagfish, gill hRhcg protein expression 519 (relative to sham-injected individuals) was seen at its highest in animals 8 hours 520 post-injection, after plasma ammonia and ammonia excretion rates were reduced to 521 control levels at (Fig 7c). The current study and the protein expression analysis 522 discussed above, provide the first insights into the regulation of a potential Rhcg 523 mediated ammonia excretion from the transcript to protein levels in the Atlantic 524 hagfish. The findings that Atlantic hagfish excrete an ammonia load primarily within 525 the first hour post injection, suggest that they may be equipped for an immediate 526 response to elevated plasma ammonia by utilizing existing Rhcg glycoproteins 527 possibly stored in sub-apical endosomes. The ammonia load immediately resulted 528 in an increase of Rhcg mRNA transcripts, which could be used to transcribe Rhcg 529 glycoprotein stores. The extreme rise in Rhcg protein levels after the bulk of the 530 ammonia load has been cleared may be an acclimation response, where the initial 531 elevated plasma ammonia levels utilize intracellular Rhcg stores and the elevated 532 expression is required to replenish and prepare the animals for future encounters 533 with high ammonia. 534 Localization of hRhcg mRNA and immunoreactive protein in the gill tissue 535 demonstrated that presence of hRhcg containing cells was seen predominantly 536 along the basal aspect of the epithelium closest to the blood margin (Fig 2c & 2d). 537 The structure of hagfish gills is unique in comparison to that of teleost gills but like 538 the gill filament of marine teleosts, the ‘filament’ of the Atlantic hagfish has a high 539 density of MRCs (3, 8). In this study, hRhcg expression was present in the 540 multilayered epithelium of the primary fold, the structural equivalent of the gill 541 filament in teleosts. The hRhcg immunolocalization was supported by localization of 542 hagfish Rhcg mRNA expression in the same region of the branchial epithelium. The 543 pattern of localization suggests that hRhcg may be responsible for the movement of 544 ammonia from the blood into the branchial epithelium. Similar to results seen in 545 teleost fishes (19), immunolocalization studies in the Pacific hagfish using a 546 heterologous teleost antibody raised against zebrafish Rhcg1, demonstrated that 547 Rhcg1 was localized to the apical membrane of NKA immunoreactive cells (1). We 548 found no evidence of colocalization of the hRhcg and NKA in the gill epithelium of 549 Atlantic hagfish. This contradiction in findings may be the result of differences 550 associated between the two genera of hagfish, of which there are many. 551 Alternatively, the use of heterologous as opposed to homologous antibodies may be 552 an issue; with no sequence data on Rhcg in Pacific hagfish it is difficult to determine 553 the homology of the amino acid sequence to that of the fugu to which the antibodies 554 used were raised. We have clearly demonstrated hRhcg immunoreactivity localized 555 within the epithelium of the skin; the immunoreactive epithelial cells that appear to 556 be associated with the cutaneous epithelium surrounding large mucous cells (Fig 557 3a,b). This localization support the results from a recent in vivo study on Pacific 558 hagfish, that demonstrated that hagfish are capable of excreting large amounts of 559 ammonia across the skin (4). To date, quantification of hRhcg protein expression in 560 the skin of hagfish has proven to be inconsistent, primarily due to low protein yields 561 associated with skin samples. 562 Among teleost fishes, the gill serves as the primary site of ammonia excretion 563 (8). Rhcg mRNA expression data from this study suggests that cutaneous routes 564 involving Rh glycoproteins may also play a role in ammonia excretion in the Atlantic 565 hagfish. Rh glycoproteins have been identified in the skin of rainbow trout (21), 566 mangrove rivulus (13), zebrafish (30) , and pufferfish (24); all experiments involving 567 exposure to high environmental ammonia (see Glover et al., 2013, for a recent 568 review of fish skin as a transport epithelium (9)). It was not within the scope of this 569 study to determine the specific contributions of branchial and extra-branchial 570 routes towards overall ammonia excretion. However, we present evidence that Rhcg 571 is expressed in the skin of the Atlantic hagfish and that cutaneous Rhcg mRNA 572 expression may respond to elevated plasma ammonia. 573 Perspectives and Significance 574 The hagfishes possess the longest known evolutionary history of the extant 575 craniates and are likely to offer exclusive insight into vertebrate origins. The 576 Atlantic hagfish is physiologically adapted to spend much of its life burrowed in 577 ocean-floor substrate and marine carcasses, where high environmental ammonia 578 and unfavorable conditions for ammonia excretion are likely encountered. The 579 current study presents evidence that suggests Atlantic hagfish are capable of 580 reducing experimentally elevated plasma ammonia concentrations and eventually 581 eliminating the ammonia load within 8 hours. Following the injection of ammonia, 582 elevated plasma ammonia concentrations paralleled elevated ammonia excretion 583 rates and coincided with the initial significant upregulation of Rhcg in the gill and 584 Rhcg in the skin suggesting that the transcriptional regulation of Rh glycoproteins 585 may respond, in part, to elevated plasma ammonia. The subsequent significant 586 upregulation of hRhcg protein suggests Rh glycoproteins are involved in the 587 regulation of ammonia excretion in Atlantic hagfish. 588 589 Funding: This research was supported by National Science Foundation grant 590 IOS#1121369 to SLE. PJW’s research is supported by a Discovery Grant from the 591 Natural Sciences and Engineering Council of Canada and the Canada Research Chairs 592 Program. OE funded by the MDIBL High school Fellowship Program, STEER. 593 Acknowledgements: 594 Special thanks go to Dr. Sue Bauldry for her assistance with the production of the 595 hRhcg antibody as well as Mr. Marcus Funston & Ms. Paige Tanner for their technical 596 assistance in additional hagfish experiments. 597 598 References: 599 1. Braun MH and Perry SF. Ammonia and urea excretion in the Pacific hagfish 600 Eptatretus stoutii: Evidence for the involvement of Rh and UT proteins. Comp 601 Biochem Physiol Part A 157: 405-415, 2010. 602 2. Brauner CJ and Baker DW. Patterns of acid-base regulation during 603 exposure to hypercarbia in fishes. In: Cardio-Respiratory Control in Vertebrates, 604 edited by Glass M and Wood SC. Berlin: Springer, 2009, p. 43-63. 605 3. Choe KP, Edwards SL, Morrison-Shetlar AI, Toop T, and Claiborne JB. 606 Immunolocalisation of Na+/K+-ATPase in mitochondrion-rich cells of the atlantic 607 hagfish (Myxine glutinosa) gill. Comp Biochem Physiol 124: 161-168, 1999. 608 4. Clifford AM, Guffey SC, and Goss GG. Extrabranchial mechanisms of 609 systemic pH recovery in hagfish (Eptatretus stoutti). Comp Biochem Physiol Part A 610 168: 82-89, 2014. 611 5. Currie S and Edwards SL. The curious case of the chemical composition of 612 hagfish tissues 50 years on. Comp Biochem Physiol 157A: 111-115, 2010. 613 6. Edwards SL, Claiborne JB, Morrison-Shetlar AI, and Toop T. NHE mRNA 614 expression in the gill of the Atlantic hagfish (Myxine glutinosa) in response to 615 metabolic acidosis. Comp Biochem Physiol Part A, 130: 81-91, 2001. 616 7. Evans DH. Gill Na+/H+ and Cl+/HCO3+ exchange systems evolved before the 617 vertebrates entered fresh water. J Exp Biol 113: 464-469, 1984. 618 8. Evans DH, Piermarini PM, and Choe KP. The Multifunctional Fish Gill: 619 Dominant Site of Gas Exchange, Osmoregulation, Acid-Base Regulation, and 620 Excretion of Nitrogenous Waste. Physiol Rev 85: 97-177, 2005. 621 9. Glover C, Bucking C, and Wood C. The skin of fish as a transport epithelium: 622 a review. J Comp Physiol B 183: 877-891, 2013. 623 10. Hardisty MW. Biology of the Cyclostomes. London: Chapman and Hall., 1979. 624 11. Huang C-H and Peng J. Evolution conservation and diversification of Rh 625 family genes and proteins. PNAS 102: 15512-15517, 2005. 626 12. Huang C-H and Ye M. The Rh protein family: gene evolution, membrane 627 biology and disease association. Cell Mol Life Sci 67: 1203-1218, 2009. 628 13. Hung CYC, Tsui KNT, Wilson JM, Nawata MC, Wood CM, and Wright PA. 629 Molecular cloning, characterization and tissue distribution of the Rhesus 630 glycoproteins Rhbg, Rhgg1 and Rhcg2 in the mangrove killifish Rivulus marmoratus 631 exposed to elevated environmental ammonia levels. J Exp Biol 210: 2419-2429, 632 2007. 633 14. Janvier P. Catching the first fish. Nature 402, 1999. 634 15. Lesser MP, Martini FH, and Heiser JB. Ecology of the hagfish Myxine 635 glutinosa L. in the Gulf of Maine. J Exp Mar Biol Ecol 208: 215-225, 1996. 636 16. Marini AM, Matassi G, Raynal V, Andre B, Cartron JP, and Cherif-Zahar B. 637 The human Rhesus-associated RhAG protein and a kidney homologue promote 638 ammonium transport in yeast. Nat Genet 26: 341-344, 2000. 639 17. Martini F, Lesser M, and Heiser JB. Ecology of hte hagfish, Myxine glutinosa 640 L ., in the gulf of Maine:II Potential impact on benthic communities and commercial 641 fisheries. J Exp Mar Biol Ecol 214: 97-106, 1997. 642 18. McDonald DG, Cavdek V, Calvert L, and Milligan CL. Acid-base regulation 643 in the Atlantic hagfish Myxine glutinosa. J Exp Biol 161: 201-215, 1991. 644 19. Nakada T, Westhoff CM, Kato A, and Hirose S. Ammonia secretion from 645 fish gill depends on a set of Rh glycoproteins. FASEB 21: 1067-1074, 2007. 646 20. Nakada T, Westhoff CM, Yamaguchi Y, Hyodo S, Xiaojin L, Muro T, Kato 647 A, Nakamura N, and Hirose S. Rhesus glycoprotein 2 (RHP2) is a novel member of 648 the Rh family of ammonia transporters highly expressed in shark kidney. J Biol Chem 649 285: 2653-2664, 2010. 650 21. Nawata CM, Hung CCY, Tsui TKN, Wilson JM, Wright PA, and Wood CM. 651 Ammonia excretion in rainbow trout (Oncorhynchus mykiss): evidence for Rh 652 glycoprotein and H+-ATPase involvement. Physiol Genomics 31: 463-474, 2007. 653 22. Nawata CM and Wood CM. The effects of CO2 and external buffering on 654 ammonia excretion and Rhesus glycoprotein mRNA expression in rainbow trout. J 655 Exp Biol 211: 3226-3236, 2008. 656 23. Nawata CM and Wood CM. mRNa expression analysiss of the physiological 657 response to ammonia infusion in rainbow trout. J Comp Physiol B 179: 799-810, 658 2009. 659 24. Nawata CM, Wood CM, and O'Donnell MJ. Functional characterization of 660 Rhesus glycoproteins from an ammoniotelic teleost, the rainbow trout, using oocyte 661 expression and SIET analysis. J Exp Biol 213: 1049-1059, 2010. 662 25. Pfaffl M. A new mathematical model for relative quantification in real-time 663 RT-PCR. Nucleic Acids Res 29: 2002-2007, 2001. 664 26. Robertson JD. chemical composition of the body fluids and muscle of the 665 hagfish Myxine glutinosa and the rabbit-fish Chimaera monstrosa. J Zool Lond 178: 666 261-277, 1976. 667 27. Robertson JD. The habitat of the early vertebrates. Biol Rev 32: 156-187, 668 1957. 669 28. Rodela TM, Esbaugh AJ, Weihrauch D, Veauvy CM, McDonald MD, 670 Gilmour KM, and Walsh PJ. Revisiting the effects of crowding and feeding in the 671 gulf toadfish Opsanus beta: the role of Rhesus glycoproteins in nitrogen metabolism 672 and excretion. J Exp Biol 215: 301-313, 2012. 673 29. Shelton RGJ. On the feeding of hagfish Myxine glutinosa in the North Sea. J 674 Mar Biol Ass UK 58: 81-86, 1978. 675 30. Shih T-H, Horng J-L, Lai Y-T, and Lin L-Y. Rhcg1 and Rhbg mediate 676 ammonia excretion by ionocytes and keratinocytes in the skin of zebrafish larvae; 677 H+-ATPase-linked active ammonia excretion by ionocytes,. Am J Physiol Regul Integr 678 Comp Physiol 304: 1130-1138, 2013. 679 31. Strahan R. The behaviour of myxionoids. Acta Zool 44: 73-102, 1963. 680 32. Suzuki A, Endo K, and Kitano T. Phylogenetic positions of RH blood group681 related genes in cyclostomes. Gene 543: 22-27, 2014. 682 33. Tresguerres M, Parks SK, and Goss GG. Recovery from blood alkalosis in 683 the Pacific hagfish (Eptatretus stoutii): involvement of gill V-H+ATPase and Na+/K+684 ATPase. Comp Biochem Physiol Part A 148: 133-141, 2007. 685 34. Tresguerres M, Parks SK, and Goss GG. V-H+ATPase, Na+/K+-ATPase and 686 NHE2 immunoreactivity in the gill epithelium of the Pacific hagfish (Eptatretus 687 stoutii). Comp Biochem Physiol Part A 145: 312-321, 2006. 688 35. Walsh PJ, Wang Y, Campbell CE, De Boeck G, and Wood CM. Patterns of 689 nitrogenous waste excretion and gill urea transporter mRNA expression in several 690 species of marine fishes. Mar Biol 139: 839-844, 2001. 691 36. Weatherburn MW. Phenol-hypochlorite reaction for determination of 692 ammonia. Anal Chem 39: 971-974, 1967. 693 37. Weihrauch D, Morris S, and Towle DW. Ammonia excretion in aquatic and 694 terrestrial crabs. J Exp Biol 207: 4491-4504, 2004. 695 38. Weihrauch D, Wilkie MP, and Walsh PJ. Ammonia and urea transporters in 696 gills of fishes and aquatic crustaceans. J Exp Biol 212: 1716-1730, 2009. 697 39. Weisbart M and Idler DR. Re-examination of the presence of corticosteriods 698 in two cyclostomes, the Atlantic hagfish (Myxine glutinosa L.) and the sea lamprey 699 (Petromyzon marinus L). J Endocrinol 46: 29-43, 1970. 700 40. Wilkie MP, Wang YL, Walsh PJ, and Youson JH. Nitrogenous waste 701 excretion by the larvae of a phylogentically ancient vertebrate: the sea lamprey 702 (Petromyzon marinus). Can J Zool 77: 707-715, 1999. 703 41. Wood CM, Kajimura M, Sloman KA, Scott GR, Walsh PJ, Almeida-Val VMF, 704 and Val AL. Rapid regulation of Na+ fluxes and ammonia excretion in response to 705 acute environmental hypoxia in the Amazonian oscar, Astronotus ocellatus. Am J 706 Physiol Regul Integr Comp Physiol 292: R2048-2058, 2007. 707 42. Wright PA and Wood CM. A new paradigm for ammonia excretion in 708 aquatic animals: Role of Rhesus (Rh) glycoproteins. J Exp Biol 212: 2303-2312, 2009. 709 710 Figure Legends 711 712 Figure 1. Phylogenetic reconstruction using neighbor-joining method with Poisson713 correction (bootstrap with 10,000 replications) of selected Rh glycoproteins and 714 the hagfish Rhcg sequence. The tree is rooted by Chlamydomonas Rhp1 (NCBI 715 Accession # XM_001695412). Bootstrap confidence estimates are shown at each 716 node and NCBI accession nos. are listed adjacent to each sequence in parentheses. 717 718 Figure 2. Representative In situ hybridization and immuohistochemistry images of 719 hagfish gills. A. In situ hybridizations which clearly shows hagfish Rhcg mRNA 720 localized to the basal aspect of the filament epithelium. Arrows highlight the 721 punctate staining pattern in the epithelial cells localized along the basal aspect of 722 the gill epithelium. Inset Representative section incubated with the sense control, 723 demonstrated no evidence of localization. B. & C Immunohistochemistry 724 representative confocal images at x20and x63 magnification of hRhcg 725 immunolocalized to the gill epithelium (Green), nuclei visualized using Nuc Red 648 726 (Red). Scale bars = 20μm 727 728 Figure 3. Representative confocal images of Hagfish specific Rhcg immunolocalized 729 to the skin of the Atlantic hagfish. A. Localization of hRhcg in the epithelial cells 730 (Red) along the basement membrane of the epidermis. B. The immunoreactive cells 731 extend from the basement membrane and surround the large mucous cells (*) 732 located in the epidermis. Scale Bars = 20μm 733 734 Figure 4. Effect of 3mmol kg-1 NH4Cl load on net ammonia flux (JAmm). Ammonia 735 excretion was significantly(*) elevated above that of controls for the first 4 hours 736 post injection, by 6 hours excretion was not longer significantly elevated. Data are 737 means + SE (n = 5). 738 739 Figure 5. The effect of 3mmol kg-1 NH4Cl load on plasma total ammonia (TAmm). 740 Plasma ammonia concentrations were significantly (*) elevated for 4 hours post 741 ammonia injection in comparison to sham controls. Data are means + SE (n = 5). 742 743 Figure 6. A. mRNA expression of hagfish Rhcg in the gills of hagfish exposed to 744 3mmol kg-1 NH4Cl. Rhcg mRNA was significantly (*) elevated in the first 15 and 30 745 minutes post injection. However in subsequent time points gill Rhcg mRNA is 746 significantly (#) down regulated in comparison to sham injected controls. Data are 747 means ± SE (n = 5). B. mRNA expression of hagfish Rhcg in the skin of hagfish 748 exposed to 3mmol kg-1 NH4Cl. Rhcg mRNA expression was significantly (*) elevated 749 at 30mins post injection. However, unlike the gill expression pattern, significant 750 down regulation of skin Rhcg mRNA expression was only seen 4 hour post injection. 751 Data are means + SE (n = 5). 752 Figure 7. Protein expression of hagfish Rhcg antibody in gill tissue. A. A 753 representative western Blot incubated in the hRhcg primary antibody demonstrated 754 a strongly immunoreactive protein in all gill samples at approximate 48kDa. B. A 755 merged image of individual western blots incubated in hagfish specific Rhcg 756 primary antibody preabsorbed in hagfish specific Rhcg peptide; Lane 1. 0.5μg/ml 757 peptide-antibody mix, Lane 2 15μg/ml peptide-antibody mix, Lane 3 2.5μg/ml 758 peptide-antibody mix, Lane 4 Pre-immune serum. M= Marker at 50 kDa. 759 C. Quantification of hRhcg protein expression in gill tissue following exposure to 760 3mmol kg-1 NH4Cl load. Significant (*) elevation of hagfish specific Rhcg (P=<0.05) 761 was seen in animals at 2, 4 and 8 hours post ammonia injection in comparison to 762 sham-injected controls. Data are means ± SE (n = 5). 763 764 765 766 Table 1. Primers used for cloning, PCR, and qPCR analysis Name Application Sequence (5′-3′) RhcgF1 deg PCR GAARRYYTSATYAACGCNGAYTT RhcgR1 deg PCR TGNAYNCCACANGTRTCMTGGAK HagRhcgF5 PCR TGGTGGATTTTTTGGTCTCGC HagRhcgB5 PCR CAATGATACCTCCGCAGAAGCC HFRhc3F 3′-RACE CGGAGCAGTTGCGGTTGGAACGG HFRhc3F2 3′-RACE nested CACCTTCATCACGCCTGCCCTGG HFRhc5R 5′-RACE CCAGGGCAGGCGTGATGAAGGTG 18S F2 qPCR GCTCTTGGATGAGTGTCCGTTG 18S R2 qPCR TTCTTGGCAAATGCTTTCGC Rhcg F1 qPCR GGTGGCACTATTGTCGGTAT Rhcg R1 qPCR CCTCCCAATATGCTCTGTCTT