Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.

نویسندگان

  • Wenbo Zhang
  • Xiaofei Lin
  • Suresh Peddigari
  • Katsuaki Takechi
  • Hiroyoshi Takano
  • Susumu Takio
چکیده

Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3' and 5' RACE suggested that PySN1 was expressed as a chimera transcript with flanking SINE-unrelated sequences and possessed the poly-A tail at the same position near the 3' end of PySN1.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Identification of miRNA from Porphyra yezoensis by High-Throughput Sequencing and Bioinformatics Analysis

BACKGROUND miRNAs are a class of non-coding, small RNAs that are approximately 22 nucleotides long and play important roles in the translational level regulation of gene expression by either directly binding or cleaving target mRNAs. The red alga, Porphyra yezoensis is one of the most important marine economic crops worldwide. To date, only a few miRNAs have been identified in green unicellar a...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

Isolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.

Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...

متن کامل

Isolation and regeneration of transiently transformed protoplasts from gametophytic blades of the marine red alga Porphyra yezoensis

Despite the recent progress of transient gene expression systems in a red alga Porphyra yezoensis by particle bombardment, a stable transformation system has yet to establish in any marine red macrophytes. One of the reasons of the difficulty in genetic transformation in red algae is the lack of systems to select and isolate transformed cells from gametophytic blades. Thus, toward the establish...

متن کامل

Toxicity of Cryoprotectants to Gametophytic Thalli of Red Algae Porphyra yezoensis

We assessed the toxicity of cryoprotectant agents (CPAs) to gametophytic thalli of red alga Porphyra yezoensis at room temperature. The CPAs used were: dimethyl sulfoxide (DMSO), ethylene glycol (EG), glycerol (GC), 1,2-butanediol (1,2-BD), 1,3-butanediol (1,3-BD), 2,3-butanediol (2,3-BD), 1,3-propanediol (1,3-PD) and propylene glycol (PG). CPA concentrations of 10, 15, 20, 25, 30, 35, 40, 45, ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Bioscience, biotechnology, and biochemistry

دوره 71 2  شماره 

صفحات  -

تاریخ انتشار 2007