Culture and molecular characterization of phages isolated from rainbow trout farms and sewage treatment plants and investigation of their effects on Yersinia ruckeri

In the present study bacteriophages isolated from rainbow trout farms and sewage treatment plants were genetically identified and their effectiveness on Yersinia ruckeri isolates from clinical cases of red mouth disease was investigated. Fish samples suspected to red mouth disease were collected from rainbow trout farms located in west Azerbaijan. Y. ruckeri, the causative agent of red mouth disease was initially identified using biochemical tests. The biotypes of all Y. ruckeri isolates were determined and their identity was confirmed by employing genus specific primers. Antimicrobial resistance of Y. ruckeri isolates were examined using common antibiotics in use in aquaculture. In order to isolating lytic bacteriophages, environmental samples mainly from rainbow trout farms and sewage treatment plants were collected in a period of six months. Isolated bacteriophages were titrated using two-layer agar method and their bactericidal effects were examined. For molecular characterization of bacteriophages, genomic DNA was extracted. Extracted genomic DNA from bacteriophages was digested using MspI endonuclease. The results revealed that 4.48% of examined fish were positive for Y. ruckeri. Bacteriophages isolated from urban sewage treatment plants were effective on Y. ruckeri isolates. Maragheh and Urmia sewage treatment plants had the maximum and minimum phage titers, respectively. The genomic DNA of all isolated phages were smaller than genomic DNA of Lambda phage and all examined phages showed similar genomic DNA digestion patterns. It was concluded that sewage treatment plants could be an important source for phages effective on Y. ruckeri and maybe other aquaculture bacterial pathogens. Keyword: Bacteriophage, Rainbow trout, Redmouth disease, Wastewater, Yersinia ruckeri. 1Division of Molecular Epidemiology, Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Urmia University, Urmia, West Azarbaijan, Iran. 2Department of Microbiology, Faculty of Veterinary Medicine,, Artemia and Aquatic Animals Research Institute, Urmia University, Urmia, West Azarbaijan, Iran. * Corresponding author's Email: [email protected] D ow nl oa de d fr om ji fr o. ir at 1 3: 17 + 03 30 o n T ue sd ay S ep te m be r 26 th 2 01 7 268 Ahmadpour et al., Culture and molecular characterization of phages isolated from rainbow trout ... Introduction Yersinia ruckeri is a Gram-negative enterobacterium, causing enteric redmouth disease (ERM) which mainly affects farmed salmonid species (Davies and Frerichs 1989; Horne and Barnes 1999). Outbreaks of certain strains of Y. ruckeri have been reported in vaccinated trout farms (Fouz et al., 2006; Arias et al., 2007). ERM is characterized by reddening of the mouth and throat, which is caused by subcutaneous haemorrhaging. Inflammation and erosion of the jaws and palate, haemorrhaging around the base of the fins, bilateral exophthalmia are other external signs of disease (Austin and Austin, 2007). In many cases of yersiniosis outbreaks, antibiotic administration is the first therapeutic and preventive measure; however, significant disadvantages accompanied with the use of antibiotics in aquaculture such as developing antibiotic resistance, necessities the need for developing alternative disease control strategies (Ryckaert et al., 2010). The emergence of pathogenic bacteria resistant to most, if not all, currently available antimicrobial agents has become a critical problem in modern medicine. Prior to the discovery and widespread use of antibiotics, it was suggested that bacterial infections could be prevented and/or treated by the administration of bacteriophages (Kutateladze and Adamia, 2010). Bacteriophages or phages are bacterial viruses that invade bacterial cells and, in the case of lytic phages, disrupt bacterial metabolism and cause the bacterium to lyse. The application of bacteriophages against bacterial infections could be an effective alternative approach for the control of bacterial infections, as the efficacy of bacteriophages against both Grampositive and Gram-negative bacteria has been reported previously (WeberDabrowska et al., 2000; Stone 2002; Inal, 2003). In addition, because of the lack of bacteriophage receptors on eukaryotic cells, they might be associated with fewer side effects compared to antibiotics (Sabouri Ghannad and Mohammadi, 2012). Human phage therapy has been practiced for the first time in France since 1919, when d'Hérelle successfully treated several children who were suffering from severe dysentery (Pirnay et al., 2011). One of the best-known recent studies on the use of phages in veterinary medicine is using phages to treat experimental E. coli infections in mice. Soothill (1994) reported the utility of phages in preventing and treating experimental disease in mice and guinea pigs infected with Pseudomonas aeruginosa and Acinetobacter, and they suggested that phages might be efficacious in preventing infections of skin grafts used to treat burn patients (Sulakvelidze et al., 2001). Bacteriophages have several characteristics that make them potentially attractive therapeutic agents. They are (i) highly specific and very D ow nl oa de d fr om ji fr o. ir at 1 3: 17 + 03 30 o n T ue sd ay S ep te m be r 26 th 2 01 7 Iranian Journal of Fisheries Sciences 15(1) 2016 269 effective in lysing targeted pathogenic bacteria, (ii) safe, as underscored by their extensive clinical use in Eastern Europe and the former Soviet Union and commercial sale of phages in the 1940s in the United States, and (iii) rapidly modifiable to combat the emergence of newly arising bacterial threats. The present study was undertaken in order to isolating bacteriophages which are effective on Yersinia ruckeri, isolated from clinical cases of ERM disease in rainbow trout and investigating the genetic variation of isolated bacteriophages. Materials and methods Examined fish for ERM During August 2009 to June 2011, a total number of 223 farmed rainbow trout fish from 21 farms of west Azerbaijan, Iran, with clinical signs of inappetence, exophthalmia and haemorrhage base of fins referred to the microbiology laboratory of Aremia and Aquatic Animals Research Institute, Urmia University were examined. Liver, kidney and blood samples were aseptically collected from diseased fish and immediately used for routine bacteriological examination. Isolation of Y. ruckeri Fish tissues were cultured aseptically by streaking a loop on to brain heart infusion (BHI) agar and MacConkey agar plates and incubated at 25°C for 48 h. Colonies of grown bacteria were subcultured on trypticase soy agar (TSA) to check purity, then cultured in trypticase soy broth (TSB) for 48 h at 25°C and identified using conventional biochemical system (Austin and Austin, 2007). Obtained biochemical results were compared with the reported biochemical properties of this bacterium in the literature (Horne and Barnes, 1999; Romalde et al., 2003; Austin and Austin, 2007). Biotyping of isolated bacteria was also undertaken using motility test and fermentation of sorbitol, Tween 80 and Tween 20 hydrolysis (Akhlaghi and Sharif Yazdi, 2008). Amplification of 16S rRNA All the isolated bacteria identified as Y. ruckeri by biochemical procedure were also confirmed using a specific PCR assay for definitive identification of Y. ruckeri. A fragment of 575 bp in size was amplified targeting 16S rRNA gene using a pair of primers YER8 (5’GCGAGGAGGAAGGGTTAAGTG3’) and YER10 (5’GAAGGCACCAAGGCATCTCTG-3’) described by Gibello et al. (1999). Bacterial genomic DNA was extracted using boiling method (Kawasaki et al., 2005). The PCR amplification was carried out in a total volume reaction of 25 μL containing 50-100 ng of genomic bacterial as described previously (Gibello et al., 1999). The amplification reaction was carried out in a gradient Mastercycler (Eppendorf, Germany) using an initial denaturation at 94oC for D ow nl oa de d fr om ji fr o. ir at 1 3: 17 + 03 30 o n T ue sd ay S ep te m be r 26 th 2 01 7 270 Ahmadpour et al., Culture and molecular characterization of phages isolated from rainbow trout ... 5 min and 35 cycles of denaturation for 1 min at 94 oC, annealing at 58oC for 1 min, and extension for 1 min at 72 oC, following by a final extension step of 72oC for 5 min. The resultant PCR products were separated on a 1.5%