Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
نویسندگان
چکیده
Homologous recombination and nonhomologous end joining (NHEJ) are important DNA double-strand break repair pathways in many organisms. C. elegans strains harboring mutations in the cku-70, cku-80, or lig-4 NHEJ genes displayed multiple developmental abnormalities in response to radiation-induced DNA damage in noncycling somatic cells. These phenotypes did not result from S-phase, DNA damage, or mitotic checkpoints, apoptosis, or stress response pathways that regulate dauer formation. However, an additional defect in him-10, a kinetochore component, synergized with NHEJ mutations for the radiation-induced developmental phenotypes, suggesting that they may be triggered by mis-segregation of chromosome fragments. Although NHEJ was an important DNA repair pathway for noncycling somatic cells in C. elegans, homologous recombination was used to repair radiation-induced DNA damage in cycling somatic cells and in germ cells at all times. Noncycling germ cells that depended on homologous recombination underwent cell cycle arrest in G2, whereas noncycling somatic cells that depended on NHEJ arrested in G1, suggesting that cell cycle phase may modulate DNA repair during development. We conclude that error-prone NHEJ plays little or no role in DNA repair in C. elegans germ cells, possibly ensuring homology-based double-strand break repair and transmission of a stable genome from one generation to the next.
منابع مشابه
Gene conversion and end-joining-repair double-strand breaks in the Caenorhabditis elegans germline.
Excision of a Mos1 transposon in the germline of Caenorhabditis elegans generates a double-strand break in the chromosome. We demonstrate that breaks are most prominently repaired by gene conversion from the homolog, but also rarely by nonhomologous end-joining. In some cases, gene conversion events are resolved by crossing over. Surprisingly, expression of the transposase using an intestine-sp...
متن کاملRapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-Conversion and Inactivation of NHEJ Repair
As in other organisms, CRISPR/Cas9 methods provide a powerful approach for genome editing in the nematode Caenorhabditis elegans. Oligonucleotides are excellent repair templates for introducing substitutions and short insertions, as they are cost effective, require no cloning, and appear in other organisms to target changes by homologous recombination at DNA double-strand breaks (DSBs). Here, I...
متن کاملInduction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells.
Zinc-finger nucleases are chimeric proteins consisting of engineered zinc-finger DNA-binding motifs attached to an endonuclease domain. These proteins can induce site-specific DNA double-strand breaks in genomic DNA, which are then substrates for cellular repair mechanisms. Here, we demonstrate that engineered zinc-finger nucleases function effectively in somatic cells of the nematode Caenorhab...
متن کاملA Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans
Ionizing radiation (IR) is commonly used in cancer therapy and is a main source of DNA double-strand breaks (DSBs), one of the most toxic forms of DNA damage. We have used Caenorhabditis elegans as an invertebrate model to identify novel factors required for repair of DNA damage inflicted by IR. We have performed an unbiased genetic screen, finding that smg-1 mutations confer strong hyper-sensi...
متن کاملAllelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans
associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Genetics
دوره 173 3 شماره
صفحات -
تاریخ انتشار 2006