Autoimmune Disease and Impaired Uptake of Apoptotic Cells in Germinal Centers of MFG-E8–Deficient Mice

نویسندگان

  • Rikinari Hanayama
  • Masato Tanaka
  • Kay Miyasaka
  • Katsuyuki Aozasa
  • Masato Koike
  • Yasuo Uchiyama
  • Shigekazu Nagata
چکیده

Materials and Methods Targeted disruption of the MFG-E8 gene The MFG-E8 chromosomal gene was isolated from a 129/sv mouse λ gene library. Exons 4–6 were replaced by a neo gene and a DNA fragment coding for the diphtheria toxin A fragment was inserted downstream of the MFG-E8 gene to produce the targeting vector. To produce MFG-E8 null mice, R1 ES cells were transfected with the targeting vector as described (S1), and G-418–resistant clones were screened for homologous recombination by PCR. The ES clones carrying the MFG-E8–deficient allele were introduced into the host embryos and used to produce chimeric mice. Chimeric mice with a high ES cell contribution were crossed with C57BL/6 mice to produce MFG-E8 mice. MFG-E8 mice were generated by crossing MFG-E8 parents, and the phenotypes of the MFG-E8 and MFG-E8 littermates were analyzed. All mice were housed in a specific pathogen-free facility. PCR, Southern and Northern blot analyses Genomic DNA was prepared as described (S2) and the genotype of the MFG-E8 gene was determined by PCR. A sense primer specific for the wild-type (5′GTGAACCTTCTGCGGAAGAT) or mutant allele (5′-CGTGGGATCATTGTTTTTCT) was used with a common antisense primer (5′-GGGCATAAACTCCAGCTCAC). For Southern hybridization, genomic DNA was digested with Eco RV and Kpn I, separated by electrophoresis on an 0.8% agarose gel and transferred to a Hybond N membrane (Amersham Biosciences). Hybridization was carried out with a 540-bp DNA fragment located outside the targeting vector. For Northern hybridization, total RNA was separated on a 1.5% agarose gel containing 2.2 M formaldehyde, transferred to a Hybond N membrane, and then hybridized with P-labeled DNA fragment as a probe.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8-deficient mice.

Apoptotic cells expose phosphatidylserine and are swiftly engulfed by macrophages. Milk fat globule epidermal growth factor (EGF) factor 8 (MFG-E8) is a protein that binds to apoptotic cells by recognizing phosphatidylserine and that enhances the engulfment of apoptotic cells by macrophages. We report that tingible body macrophages in the germinal centers of the spleen and lymph nodes strongly ...

متن کامل

An Apoptosis-Associated Mammary Protein Deficiency Leads to Enhanced Production of IgM Antibodies against Multiple Damage-Associated Molecules

Milk fat globule epidermal growth factor 8 (MFG-E8) is a protein that binds to apoptotic cells by recognizing phosphatidylserine and enhances the engulfment of apoptotic cells by macrophages. Many apoptotic cells are left unengulfed in the germinal centers of the spleen in the MFG-E8-deficient (MFG-E8(-/-)) mice, and these mice develop an autoimmune disease resembling human systemic lupus eryth...

متن کامل

Milk fat globule EGF factor 8 in the serum of human patients of systemic lupus erythematosus.

Mouse milk fat globule epidermal growth factor 8 (MFG-E8), which is secreted by a subset of activated macrophages, binds to apoptotic cells by recognizing phosphatidylserine and promotes their engulfment. Many apoptotic cells are left unengulfed in the germinal centers of the spleen in MFG-E8(-/-) mice, and these mice develop an autoimmune disease resembling human systemic lupus erythematosus (...

متن کامل

Synergistic effect of Tim4 and MFG-E8 null mutations on the development of autoimmunity.

Phagocytes, including macrophages, recognize phosphatidylserine exposed on apoptotic cells as an "eat me" signal. Milk Fat Globule EGF Factor VIII (MFG-E8) is secreted by one subset of macrophages, whereas Tim4, a type I membrane protein, is expressed by another. These proteins bind tightly to phosphatidylserine on apoptotic cells and enhance their engulfment by macrophages. To study the contri...

متن کامل

Autoimmunity in MFG-E8-deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens.

Apoptotic cells must be rapidly cleared, as defects in this process can lead to autoimmunity. Milk fat globule EGF factor 8 (MFG-E8) binds to apoptotic cells and facilitates their removal through interaction with phagocytes. Mice deficient in MFG-E8 develop lupus-like autoimmunity associated with accumulation of apoptotic cells in vivo. Here, we have shown that MFG-E8 controls phagocytic ingest...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2004