Entwicklung von Testsystemen auf der Basis der "Loop Mediated Isothermal Amplification (LAMP)" Methode zum Nachweis von Yersinia ruckeri, dem Erreger der Rotmaulseuche (ERM) und von Renibacterium salmoninarum, dem Erreger der bakteriellen Nierenkrankheit (BKD) der Salmoniden
نویسندگان
چکیده
Background: Enteric Redmouth (ERM) disease also known as Yersiniosis is a contagious disease affecting salmonids, mainly rainbow trout. The causative agent is the gram-negative bacterium Yersinia ruckeri. The disease can be diagnosed by isolation and identification of the causative agent, or detection of the Pathogen using fluorescent antibody tests, ELISA and PCR assays. These diagnostic methods are laborious, time consuming and need well trained personnel. Results: A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for detection of Y. ruckeri the etiological agent of enteric red mouth (ERM) disease in salmonids. The assay was optimised to amplify the yruI/yruR gene, which encodes Y. ruckeri quorum sensing system, in the presence of a specific primer set and Bst DNA polymerase at an isothermal temperature of 63°C for one hour. Amplification products were detected by visual inspection, agarose gel electrophoresis and by real-time monitoring of turbidity resulted by formation of LAMP amplicons. Digestion with HphI restriction enzyme demonstrated that the amplified product was unique. The specificity of the assay was verified by the absence of amplification products when tested against related bacteria. The assay had 10-fold higher sensitivity compared with conventional PCR and successfully detected Y. ruckeri not only in pure bacterial culture but also in tissue homogenates of infected fish. Conclusion: The ERM-LAMP assay represents a practical alternative to the microbiological approach for rapid, sensitive and specific detection of Y. ruckeri in fish farms. The assay is carried out in one hour and needs only a heating block or water bath as laboratory furniture. The advantages of the ERM-LAMP assay make it a promising tool for molecular detection of enteric red mouth disease in fish farms. Background Yersiniosis or enteric red mouth disease (ERM) is a serious systemic bacterial infection of fishes which causes significant economic losses in salmonid aquaculture worldwide [1]. Although infection with this agent has been reported in other fish species, salmonids especially rainbow trout Published: 12 August 2008 BMC Veterinary Research 2008, 4:31 doi:10.1186/1746-6148-4-31 Received: 29 May 2008 Accepted: 12 August 2008 This article is available from: http://www.biomedcentral.com/1746-6148/4/31 © 2008 Saleh et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Page 1 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 Oncorhrynchus mykiss, are highly susceptible to ERM [2,3]. The disease was first described in the rainbow trout in the United State in 1958, from Hagerman Valley, Idaho by Rucker [4], and later the causative organism named Yersinia ruckeri [5]. The disease is endemic in North America [3] and widespread elsewhere. It was also described in 1981 in France, Germany and United Kingdom and has now been reported in most of Europe, Australia [6,7] and South Africa [8]. The causative agent, Yersinia ruckeri, is a gram-negative, non-spore-forming rod-shaped bacterium with rounded ends and like the other members of the Enterobacteriaceae family is glucose-fermentative, oxidase-negative and nitrate-reductive [9,10]. ERM outbreaks usually begin with low mortality, and then escalate to result in high losses. Characteristic symptoms of ERM are haemorrhages of the mouth and gills, though these are rarely seen in acute infections but may be present in chronic infections, diffuse haemorrhages within the swim bladder, petechial haemorrhage of the pyloric caecae, bilateral exophthalmia, abdominal distension as a result of fluid accumulation, general septicaemia with inflammation of the gut, the spleen is often enlarged and can be almost black in colour [4]. Transmission occurs by direct contact with carrier fish, other aquatic invertebrates and birds [4,11]. The ability of Y. ruckeri to survive and remain infective in the aquatic environment is considered to be a major factor in spread of the disease. Furthermore, Y. ruckeri is able to form biofilms and grow on surfaces and solid supports in fish tanks, like many bacteria in aquatic environments, which lead to recurrent infections in rainbow trout farms [12]. Although vaccination has for a decade been very successful in the control of infections caused by Y. ruckeri in trout farms [13], cases of yersiniosis have been reported in trout farms where vaccination didn't provide enough protection against the infection [14] and due to carrier state [13]. Different diagnostic methods have been developed for detection of Y. ruckeri including culturing, serological and molecular techniques. Isolation and identification using agar media and the organism's biochemical characteristics are considered the gold standard for Y. ruckeri diagnosis. Serological methods for detection of Y. ruckeri have also been developed and these include ELISA, agglutination, and the immunofluorescence antibody technique (IFAT) [15]. Molecular techniques are able to detect low levels of the bacterium and facilitate detection of asymptomatic carriers, which is very important for prevention of ERM transmission and spread [16]. Restriction fragmentation-length polymorphism [17] and PCR assays [18-20] are widely used for detection of low levels of Y. ruckeri in infected trout tissues and blood and also for detection of asymptomatic carriers. Although PCR has been shown to be a powerful and sensitive tool in detection of Y. ruckeri, its requirements for expensive equipments, a precision thermocycler and laboratory training limit its use in the field as a routine diagnostic tool. Alternate isothermal nucleic acid amplification methods, which require only a simple heating device, have been developed to offer feasible platforms for rapid and sensitive detection of a target nucleic acid. These include nucleic acid-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and ramification amplification [21-23]. LAMP is a nucleic acid amplification method that synthesises large amounts of DNA in a short period of time with high specificity [22,24]. The strand displacement activity of Bst DNA polymerase impels auto-cyclic DNA synthesis with loop-forming primers to yield long-stem loop products under isothermal conditions: 60–65°C for about 60 min [22,25]. The LAMP reaction requires four or six primers that target six or eight separate DNA sequences on the target and give the assay very high specificity [22,25]. LAMP amplification products can be detected by gel electrophoresis, by real time monitoring of turbidity with a turbidimeter [24,26] or with the naked-eye. Visual detection can be accomplished using different methods such as detection of a white precipitate (magnesium pyrophosphate), use of an intercalating DNA dye such as SYBR Green I gel stain [27], use of florescent detection reagent, FDR, [28], or use of oligonucleotide probes labelled with different fluorescent dyes and low molecular weight cationic polymers such as polyethylenimine, PEI [29]. LAMP-based assays have been developed for numerous aquaculture animal pathogens, including white spot syndrome virus [30], yellow head virus [31], Edwardsiella tarda [32] and Nocardia seriolae [33], Tetracapsuloides bryosalmonae, Myxobolus cerebralis, Thelohania contejeani [3436], Koi herpes virus (CyHV-3) and viral hemorrhagic septicaemia (VHS) [27,37]. The objective of this study was to develop and evaluate LAMP, as a simple, rapid and sensitive diagnostic tool for ERM disease. Methods Bacteria The bacterial strains used in this study were listed in (table 1). Y. ruckeri strains were cultured on trypticase-soy-agar [3]. The purity of the cultures was tested with Gram stain and confirmed biochemically with the API 20E rapid identification system. Each strain from other bacterial strains was propagated on its specific medium and then tested by Gram stain and biochemically. DNA extraction DNA was extracted from bacterial cultures using QIAamp® DNA mini kit (QIAGEN, Hilden, Germany). Bacterial Page 2 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 cells were harvested in a microcentrifuge tube by centrifugation at 5000 × g for 10 min. Cell pellets were re-suspended in 180 μl lysis buffer (20 mg/ml lysozym; 20 mM Tris-HCl, pH 8.0; 2 mM EDETA; 1.2% Triton) and incubated at 37°C for 30 min. Proteinase K and Buffer AL were then added and mixed by vortexing. After 30 min incubation at 56°C, ethanol was added and thoroughly mixed to yield a homogenous solution. DNA was then extracted as per manufacturer's instructions. DNA was extracted from tissue samples (liver, kidney, spleen) by QIAamp® DNA mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions following the animal tissues protocol. Oligonucleotide primers ERM-LAMP primers were designed according to the published sequence of yruI/yruR (GenBank accession number AF274748, [20]) using Primer Explorer version 4 (Net Laboratory, Tokyo, Japan). Five primers were constructed; two outer primers F3 and B3, two inner primers: forward inner primer (FIP) backward inner primer (BIP) and loop forward primer (LF). FIP comprised the F1c sequence complementary to F1, a TTTT linker, and F2 sequence. BIP consisted of the B1c sequence complementary to B1, a TTTT Linker and B2 sequence. After modification of the 3' end with Rox, the loop forward primer LF was used as an Oligo DNA Probe (ODP). PCR specific primers IF-2 and IR-2 were used to amplify 1000 bp of yruI/yruR genes of Y. ruckeri [20]. Details of the LAMP and PCR primers are given in (Table 2). Optimization of ERMLAMP condition ERM-LAMP reactions were carried out in a Loopamp realtime turbidimeter (LA-200, Teramecs Co., Ltd., Kyoto, Japan) at 60, 63 and 65°C, for 30, 45 and 60 min, followed by 80°C for 2 min to terminate the reaction. The reaction mixture contained 40 pmol each of inner primers FIP and BIP, 5 pmol each of outer primers F3 and B3, 20 pmol of LF (forward loop primer), 1.4 mM of dNTP mix, 1.6 M betaine (Sigma-Aldrich, GmbH, Schnelldorf, Germany), 4.5 mM MgSO4, 8 U of Bst DNA polymerase (New England Biolabs GmbH, Frankfurt, Germany), 1× of the supplied Thermopol buffer, and a specified amount of template DNA in a final volume of 25 μl. Reaction mix without DNA template was included as a negative control. PCR amplification Amplification was performed in a 50 μl reaction volume with 2× ready mix PCR Master mix (Thermo Scientific, Hamburg, Germany) which contained (75 mM Tris-HCl (pH 8.8), 20 mM (NH4)2 SO4, 1.5 mM MgCl2, 0.01% Tween-20, 0.2 mM each nucleotide triphosphate, 1.25 U thermoprime plus DNA polymerase, and red dye for electrophoresis), 1.5 μl of DNA template and 20 pmol each of forward and reverse primers. The amplification was carried out in Mastercycler Gradient thermocycler, Eppendorf, with the following cycling profile: 94°C for 2 min, then 40 PCR cycles of 92°C for 1 min (DNA denaturation), 65°C for 1 min (primer annealing) and 72°C for 1.5 min (DNA extension), with a terminal extension step of 72°C for 5 min. Table 1: Bacterial species assayed in ERM-LAMP experiments Bacterial Strains Source Y. ruckeri DSMZ1 18506 (ATCC 29473) Y. ruckeri CECT2 955 Y. ruckeri CECT 956 Y. ruckeri Dr. Joachim Nils3 Y. aldovae DSMZ 18303 (ATCC 35236) Y. enterocolitica DSMZ 4780 (ATCC 9610) Y. frederiksenii DSMZ 18490 (ATCC 33641) Y. intermedia DSMZ 18517 (ATCC 29909) Y. kristensenii DSMZ 18543(ATCC 33638) Aeromonas salmonicida Clinic for Fish and Reptiles Aeromonas sorbia Clinic for Fish and Reptiles Renibacterium salmoninarum Clinic for Fish and Reptiles Flavobacterium columnare Clinic for Fish and Reptiles Pseudomonas aeroginosa Clinic for Fish and Reptiles 1) DSMZ: Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (German Collection of Micro-organisms and Cell Cultures) Braunschweig, Germany. 2) CECT: Colección Española de Cultivos Tipo (Spanish Type Culture Collection) Valencia, Spain. 3) Fischgesundheitsdienst im Staatlichen Untersuchungsamt, Veterinäruntersuchungsamt Mittelhessen, Giessen, Germany. Table 2: Details of oligonucleotide primers used for ERM-LAMP assay and PCR assay. Primer name Length Sequence (5'-3') F3 20-mer TCGATATAGTTACCTTCCGG B3 18-mer ATGGGCAGTGAACTGTAG FIP 46-mer TGTTCGTTTATTGAACTTCACCGATTTTCGTCGAACTGAGCGTTAA BIP 50-mer AAGCTGATTTCCATAAATTCCGAGTTTTTAATGACATGGAGTTTGATGAG Loop Forward(LF) 25-mer AGGTATCGTGTGTTAGGATTATCGT ODP 25-mer AGGTATCGTGTGTTAGGATTATCGT-Rox IF-2 24-mer GAGCGCTACGACAGTCCCAGATAT IR-2 24-mer CATACCTTTAACGCTCAGTTCGAC Page 3 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 Detection of the amplification products Three detection methods were used: real-time turbidity detection, agarose gel analysis and visual detection. Changes in absorbance at 650 nm were measured for realtime turbidity detection with a Loopamp real-time turbidimeter (LA-200). A cut off value was determined based on the mean of the negative detection control optical density. Specimens with an optical density of less than 0.1 were determined to be negative for Y. ruckeri bacterial DNA. LAMP and PCR amplification products were analysed by gel electrophoresis stained with GelRedTM Nucleic Acid Gel Stain, 10,000× in water (BIOTREND Chemikalien GmbH, Köln, Germany) and then visualised under UV light. A TrackItTM 100 bp DNA ladder (Invitrogen GmbH, Karlsruhe, Germany) was used as molecular weight marker. Visual detection of the LAMP products was carried out either by using 1 μl of Fluorescent Detection Reagent, FDR, (Eiken Chemical Co., Ltd) added before incubation of the reaction mixture at 63°C, or by addition of 1 μl of 1:10 diluted SYBR Green I nucleic acid gel stain 10,000 × concentration in DMSO (Cambrex BioSceince, Rockland, Inc., ME, USA) to the LAMP product after termination of the reaction. Any colour changes of the reaction mixture were noted. For detection with Roxlabelled probe, 0.2 μmol of low molecular weight PEI (Wako chemical GmbH, Neuss, Germany) was added to the LAMP product after centrifugation for 10 s at 6000 rpm to form insoluble PEI-amplicon complex, containing the Roxlabelled probe, which was precipitated by additional centrifugation at 6000 rpm for 10 s. Reaction tubes were then visualised under a conventional UV illuminator or by fluorescence microscopy. Restriction analysis digestion of the ERMLAMP products To confirm the structure of the LAMP amplicons, it was purified using a High pure PCR purification kit (Roche Molecular Biochemicals, Mannheim, Germany) and then subjected to digestion with restriction enzyme HphI (New England BioLabs GmbH, Frankfurt, Germany). Fragment sizes were analyzed by 2% agarose gels electrophoresis stained with GelRedTM Nucleic Acid Gel Stain, 10,000× in water (BIOTREND Chemikalien GmbH, Köln, Germany) and then visualised under UV light. ERMLAMP assay specificity DNAs from Y. ruckeri strains and from other bacterial strains (Y. aldovae, Y. enterocolitica, Y. frederiksenii, Y. intermedia, Y. kristensenii, Aeromonas salmonicida, Aeromonas sorbia, Pseudomonas aeruginosa, Renibacterium salmoninarum and Flavobacterium columnare) were tested by ERMLAMP assay to assess the specificity of the constructed primers. DNA from non-infected fish tissues and a negative LAMP reaction control were used to detect any nonspecific amplification. Sensitivity of the ERM-LAMP assay One microgram genomic Y. ruckeri DNA was 10-fold serially diluted to assess the lower detection limit of the LAMP assay compared with conventional PCR. The products were analysed visually and by 2% agarose gel electrophoresis. Feasibility of the ERMLAMP assay The use of the ERM-LAMP assay to detect Y. ruckeri DNA in clinical specimens was evaluated by testing 15 rainbow trout samples infected with ERM submitted to our clinic and 4 control fish samples. These fish were suffering from diffuse haemorrhages in the swim bladder and enlarged black spleen. The samples were tested by both ERM-LAMP assay and PCR assay. Results Optimal amplification of the Y. ruckeri yruI/yruR gene by ERM-LAMP assay was obtained at 63°C for 60 min, as shown by both agarose gel electrophoresis and real time turbidity measurements. Amplified products exhibited a ladder-like pattern on the gel (Fig. 1). Specificity of the amplification was confirmed by digestion of the LAMP products using HphI restriction enzyme (Fig. 1), the sizes of the resultant digestion products were as predicted (87 bp and 108 bp). Results obtained with the visual detection methods correlated with agarose gel electrophoresis results. When FDR used, a strong green fluorescence was emitted by LAMP positive reactions (F ig. 2, Tube No.3) when exposed to UV light and no fluorescence was evident for a negative reaction (Fig. 2, Tube No. 4). Likewise, after addition of SYBR Green I dye, the ERM-LAMP products appeared green (Fig. 2, Tube No. 5), while in the negative control tube the original orange colour of SYBR Green I did not change (Fig. 2, Tube No. 6). With Roxlabelled probe, a pellet formed emitted a red fluorescence for a positive reaction (Fig. 2, Tube No. 2), but there was neither pellet nor fluorescence observed in the negative control tube (Fig. 2, Tube No. 1). The specificity of ERM-LAMP primers was confirmed by amplification of yruI/yruR gene from all Y. ruckeri tested strains while there are no amplification products detected from the other bacterial species, non-infected fish tissues or negative (no template) LAMP reaction control (Fig. 3). Both agarose gel electrophoresis and visual detection methods showed that, the lower detection limit of the ERMLAMP method is 10-6 dilution, which equal to 1 pg of the Y. ruckeri genomic DNA (Fig. 4), while PCR showed no amplification after a dilution of 10-5 which equal to 10 pg Y. ruckeri genomic DNA (Fig. 5). The LAMP assay detected Y. ruckeri DNA from 15 infected fish samples, which were also positive by PCR (Fig. 6 &7). Samples from all 4 control fish were negative in both assays. Page 4 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 Discussion Efficient, rapid and timely diagnosis is critical for successful management of diseases in aquaculture. For field diagnosis, the optimal detection system should be economical, quick, and easy to operate, moreover should meet the requirements of specificity and sensitivity [38]. ERM disease is a serious infection that causes sever economic losses in salmonid aquaculture. It usually occurs as an acute condition with high morbidity and mortality rates, which necessitates rapid and accurate methods for detection of its causative agent, Y. ruckeri [18]. A traditional microbiological approach for isolation and identification usually takes 2 to 3 days, and given that different numerical profiles for Y. ruckeri can be obtained with commercial multi-substrate identification systems, particularly the API 20E system, they must be interpreted with caution [3]. Although PCR assays are more accurate, specific, and faster than the microbiological approach [1820], they require precision equipments which are beyond the capacity of most diagnostic sites to purchase, maintain and operate, and the complexity of the assay procedures obviates the possibility of point-of-care use. In this study, a rapid and sensitive diagnostic system based on LAMP technology was developed to detect Y. ruckeri. The ERM-LAMP assay requires only a simple water bath or heating block to incubate the reaction mixture at 63°C for 1 hr before the reaction products are visualised. The assay utilizes a single DNA polymerase that is active at relatively high isothermal amplification temperatures, which diminishes the probability of non-specific priming [39]. The yruI/yruR quorum sensing system encoding gene of Y. ruckeri was chosen as a suitable target, as it controls virulence gene expression through cell to cell communication and has great potential for rapid and specific identification of this fish pathogen [20]. Although there is a serotypic diversity among Y. ruckeri strains [40,41], yruI/ yruR gene was amplified from all Y. ruckeri tested strains by PCR and produced one RFLP pattern which demonstrate a high degree of genotypic homogeneity among Y. ruckeri strains regarding this gene [20]. A LAMP assay requires at least 4 highly specific primers to distinguish six distinct regions on the target DNA [42]. In developing the ERM-LAMP assay, several primer sets were appraised, with the most effective set presented here. The assay was optimized to amplify Y. ruckeri at 63°C using a set of 4 or 5 primers. In initial trials of the assay, a characteristic ladder-like pattern of LAMP amplification is demonstrated upon gel electrophoresis [43] and confirmed the identity of the product by HphI digestion. The ERMLAMP assay was able to amplify the target yruI/yruR gene from all Y. ruckeri tested strains while it did not show any cross-reactivity with a panel of DNAs from other Yersinia species or from other related bacterial species, which confirm its specificity. Due to the isothermal nature of the LAMP assay, there is no time lost in temperature cycling, which leads to extremely high efficiency compared with regular PCR [22,44]. Another advantage of LAMP is that real-time monitoring of the reaction is possible [24] and this decreases the time needed to get results and reduces the risk of carry-over contamination in the post-PCR process [45]. Alternatively, LAMP reaction products can be visualized using SYBR Green I nucleic gel stain which has high binding affinity to double stranded DNA and hence turns from orange to green as the LAMP amplicons are produced [46,47]. LAMP product can also be monitored by placing a reaction tube directly on a UV transilluminator; when the FDR added into the reaction mixture. The calcein in FDR is initially combined with manganese ions and is quenched, but as amplification generates by-product pyrophosphate ions, these bind to and remove manganese from the calcein, resulting in fluorescence which is intensified further as calcein combines with magnesium ERM-LAMP Figure 1 ERM-LAMP. Yersinia ruckeri loop-mediated isothermal amplification (ERM-LAMP) products and restriction analysis of ERMLAMP product with HphI enzyme. Lane Mar = 100base-pair DNA ladder, lane Y. ruc = Amplified Y. ruckeri LAMP product shows a ladder-like pattern, lane Y. ruc dig = Digested Y. ruckeri LAMP product with HphI with production of 87 bp and 108 bp bands, lane – veco = Negative (No template) control. Page 5 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 ions [28,45]. On the other hand, if low molecular weight PEI is used, this forms an insoluble complex with high molecular weight DNAs, like LAMP products, which then captures the hybridized Rox-labelled probe into a pellet which fluoresces red under UV light [29]. All of our data confirmed that visual detection of assay results was compatible with the real-time turbidity measurement and agarose gel electrophoresis. Hence simple visual detection facilitates use of the assay in basic laboratories and in fish farms. Compared with biochemical, microbial culture methods and PCR assay (24–48 hrs, 3 hrs respectively); the ERMLAMP is convenient, rapid, and sensitive. The ERM-LAMP Visual detection of ERM-LAMP product F gure 2 Visual detection of ERM-LAMP product. Using different naked eye detection methods: 1 = Negative control of ERMLAMP reaction using Roxlabelled probe, there is neither pellet nor red fluorescence; 2 = Positive ERM-LAMP reaction using Roxlabelled probe, the pellet emitted red fluorescence; 3 = positive sample by using FDR, emitted strong green fluorescence when exposed to UV light; 4 = negative sample by using FDR, did not emitted strong green fluorescence under UV light; 5 = positive sample with green colour by using SYBR green I stain; 6 = negative sample with orange colour by using SYBR green I stain. Specificity of ERM-LAMP primers for detection of Y. ruckeri DNA Figure 3 Specificity of ERM-LAMP primers for detection of Y. ruckeri DNA. Lane Mar = 100-base-pair DNA ladder, lane Y. ald = DNA from Yersinia aldovae, lane Y. ent = DNA from Yersinia enterocolitica, lane Y. fre = DNA from Yersinia frederiksenii, lane Y. int = DNA from Yersinia intermedia, lane Y. kri = DNA from Yersinia kristensenii, lane A. sal = DNA from Aeromonas salmonicida, lane A. sor = DNA from Aeromonas sorbia, lane P. aer = DNA from Pseudomonas aeruginosa, lane R. sal = DNA from Renibacterium salmoninarum, lane F. col = DNA from Flavobacterium columnare, lane NF = DNA from non-infected Fish tissues, lane Y. ruc = DNA from Yersinia ruckeri, lane – veco = Negative control. Page 6 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 assay is 10-fold more sensitive than regular PCR as it detected a very low concentration of Y. ruckeri genomic DNA (1 pg), while the PCR can detect only till 10 pg Y. ruckeri genomic DNA. The assay successfully detected Y. ruckeri DNA in infected fish samples and hence appears suitable for use with clinical specimens. Conclusion Loop mediated isothermal amplification assay as a new diagnostic tool for diagnosis of ERM disease in salmonids was developed and evaluated. The ERM-LAMP assay is rapid, as its result appeared after one hour, and sensitive than the conventional diagnostic method of ERM disease. The ERM-LAMP assay requires only a regular laboratory Sensitivity of ERM-LAMP assay Figure 4 Sensitivity of ERM-LAMP assay. Lower detection limit of the Yersinia ruckeri DNA by LAMP assay. Lane Mar = 100-basepair DNA ladder, lane 1–10 = 10-fold serial dilution of 1 μg Yersinia ruckeri DNA from 10-1-10-10; lane – veco = No template control. Sensitivity of ERM-PCR assay Figure 5 Sensitivity of ERM-PCR assay. Lower detection limit of (1000 bp fragment) Yersinia ruckeri DNA by PCR. Lane Mar = 100base-pair DNA ladder, lane 1–9 = 10-fold serial dilution of 1 μg Yersinia ruckeri DNA from 10-1-10-9; lane – veco = No template control. Page 7 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 water bath and is hence suitable as a routine diagnostic tool in private clinics and field applications where equipment such as thermal cycling machines and electrophoresis apparatus are not available. Authors' contributions MS carried out all the experimental work, data acquisition and drafted the manuscript. HS participated in the design of the study, analysis and interpretation of the data and helped to draft the manuscript. ME–M conceived and supervised the study, and revised the manuscript critically Feasibility of ERM-LAMP assay igure 6 Feasibility of ERM-LAMP assay. Detection of Yersinia ruckeri DNA from 15 infected kidney samples by ERM-LAMP while there is no amplifications appeared with the non-infected kidney samples. Lane Mar = 100-base-pair DNA ladder, lanes 1–15 = DNA from infected kidney samples, lanes 16–19 = DNA from non-infected kidney samples. Feasibility of ERM-PCR assay igure 7 Feasibility of ERM-PCR assay. Detection of Yersinia ruckeri DNA from 15 infected kidney samples by ERM-PCR while there is no amplifications appeared with the non – infected kidney samples. Lane Mar = 100-base-pair DNA ladder, lanes 1–15 = DNA from infected kidney samples, lanes 16–19 = DNA from non-infected kidney samples. Page 8 of 10 (page number not for citation purposes) BMC Veterinary Research 2008, 4:31 http://www.biomedcentral.com/1746-6148/4/31 for important intellectual content. All authors read and approved the final manuscript. AcknowledgementsThe Authors are grateful for Dr. Joachim Nils, Fischgesundheitsdienst imStaatlichen Untersuchungsamt, Veterinäruntersuchungsamt Mittelhessen,Giessen, Germany, for providing Yersinia ruckeri strain used in this endeav-our. We would like also to thank Dr. Sieghard Frischmann, Mast Diagnos-tica Laboratoriumspräparate GmbH, Reinfeld, Germany, for providing usthe real-time turbidimeter LA-200. References1. Raida MK, Buchmann K: Bath vaccination of rainbow trout(Oncorhynchus mykiss Walbaum) against Yersinia ruckeri:Effects of temperature on protection and gene expression.Vaccine 2008, 26:1050-1062.2. Austin B, Austin DA: Bacterial Fish Pathogens: Disease offarmed and wild fish. 3rd edition. Praxis Publishing Ltd, Chiches-ter, UK; 1993.3. Furones MD, Rodgers CJ, Munn CJ: Yersinia ruckeri, the causativeagent of enteric redmouth disease (ERM) in fish. Ann Rev FishDis 1993, 3:105-125.4. Rucker R: Redmouth disease of Rainbow trout (Salmo gaird-neri). Bull Off Int Epizoot 1966, 65(5):825-830.5. Ewing WH, Ross AJ, Brenner DJ, Fanning GR: Yersinia ruckeri sp.Nov., the redmouth (RN) bacterium. Int J Syst Bacteriol 1978,28:37-44.6. Bullock GL, Stuckkey HM, Shotts EB Jr: Enteric redmouth bacte-rium: comparison of isolates from different geographicareas. J Fish Dis 1978, 1:351-356.7. Llewellyn LC: A bacterium with similarities to the redmouthbacterium and Serratia liquefaciens (Grimes and Hennerty)causing mortalities in hatchery-reared salmonids in Aus-tralia. J Fish Dis 1980, 3:29-39.8. Bragg RR: Health status of salmonids in river systems in Natal(South Africa). III. Isolation and identification of bacteria.Onderstepoort J Vet Res 1991, 58:67-70.9. Ross AJ, Rucker RR, Ewing WH: Discription of a bacterium asso-ciated with redmouth disease of rainbow trout (Salmo gaird-neri). Can J Microbiol 1966, 12:763-770.10. Post G: Text book of fish health TFH Publication, Inc, Neptune City, NJ;1987.11. Willumsen B: Birds and wild fish as potential vectors of Yersiniaruckeri. J Fish Dis 1989, 12:275-277.12. Coquet L, Cosette P, Junter GA, Beucher E, Saiter JM, Jouenne T:Adhesion of Yersinia Ruckeri to fish farm materials: influenceof cell and material surface properties. Colloids and surfaces B:Biointerfaces 2002, 26:373-378.13. Stevenson RMW: Immunization with bacterial antigens: Yers-iniosis. Dev Biol Stand 1997, 90:117-124.14. Austin DA, Robertson PAW, Austin B: Recovery of a new bio-group of Yersinia ruckeri from diseased rainbow trout (Onco-rhynchus mykiss, Wahlbaum). Syst Appl Microbiol 2003,26:127-131.15. Smith AM, Goldring OL, Dear G: The production and methodsof use of polyclonal antisera to the pathogenic organismsAeromonas salmonicida, Yersinia ruckeri, and Renibacteriumsalmoninarum. J Fish Biol 1987, 31A:225-226.16. Tobback E, Decostere A, Hermans K, Haesebrouck F, Chiers K: Yers-inia ruckeri infections in salmonid fish. J Fish Dis 2007,30:257-268.17. Garcia JA, Dominguez L, Larson JL, Pederson K: Ribotyping andplasmid profiling of Yersinia ruckeri. J Appl Microbiol 1998,85:949-955.18. Gibello A, Blanco MM, Moreno MA, Cutuli MT, Domenech A,Dominguez L, Fernandez-Garayzabal JF: Development of a PCRassay for detection of Yersinia ruckeri in Tissues of inoculatedand naturally infected trout. Appl Environ Microbiol 1999,65:346-350.19. Altinok I, Grizzle JM, Liu Z: Detection of Yersinia ruckeri in rain-bow trout blood by use of polymerase chain reaction. DisAquat Org 2001, 44:29-34.20. Temprano A, Yugueros J, Hernanz C, Sanchez M, Berzal B, Luengo JM,Naharro G: Rapid identification of Yersinia ruckeri by PCRamplification of yruIyruR quorum sensing. J Fish Dis 2001,24:253-261.21. Compton J: Nucleic acid sequence-based amplification. Nature1991, 350:91-92.22. Notomi T, Okayama H, Yonekawa T, Watanabe K, Amino N, Hase T:Loopmediated isothermal amplification of DNA. NucleicAcids Res 2000, 28:63.23. Zhang DY, Brandwein M, Hsuih T, Li HB: Ramification amplifica-tion: A novel isothermal DNA amplification method. MolDiagn 2001, 6:141-150.24. Mori Y, Kitao M, Tomita N, Notomi T: Real-Time turbidimetry ofLAMP reaction for quantifying template DNA. J Biochem Bio-phys Methods 2004, 59:145-157.25. Nagamine K, Hase T, Notomi T: Accelerated reaction by Loop-mediated isothermal amplification using loop primers. MolCell Probes 2002, 16:223-229.26. Mori Y, Nagamine K, Tomita N, Notomi T: Detection of loop-mediated isothermal amplification reaction by turbidityderived from magnesium pyrophosphate formation. BiochemBiophys Res Commun 2001, 289:150-154.27. Soliman H, El-Matbouli M: An inexpensive and rapid diagnosticmethod of the koi herpesvirus (KHV) infection by loop-medi-ated isothermal amplification. Virol J 2005, 2:83.28. Yoda T, Suzuki Y, Yamazaki K, Sakon N, Aoyama I, Tsukamoto T:Evaluation and application of reverse transcription loop-mediated isothermal amplification for detection of norovi-ruses. J Med Virol 2007, 79:326-334.29. Mori Y, Hirano T, Notomi T: Sequence specific visual detectionof LAMP reactions by addition of cationic polymers. BMC Bio-technol 2006, 6:3.30. Kono T, Savan R, Sakai M, Itami T: Detection of white spot syn-drome virus in shrimp by loop-mediated isothermal amplifi-cation. J Virol Methods 2004, 115:59-65.31. Mekata T, Kono T, Svan R, Sakai M, Kasornchandra J, Yoshida T, ItamiT: Detection of yellow head virus in shrimp by loop-mediatedisothermal amplification. J Virol Methods 2006, 135:151-156.32. Savan R, Igarashi A, Matsuoka S, Sakai M: Sensitive and rapiddetection of edwardsiellosis in fish by a loop-mediated iso-thermal amplification method. Appl Environ Microbiol 2004,70:621-624.33. Itano T, Kawakami H, Kono T, Sakai M: Detection of fish nocardi-osis by loop-mediated isothermal amplification. J Appl Micro-biol 2005, 100:1381-1387.34. El-Matbouli M, Soliman H: Rapid diagnosis of Tetracapsuloidesbryosalmonae, the causative agent of proliferative kidney dis-ease (PKD) in salmonid fish by a novel DNA amplificationmethod loop mediated isothermal amplification (LAMP).Parasitol Res 2005, 96:277-284.35. El-Matbouli M, Soliman H: Development of a rapid assay fordiagnosis of Myxobolus cerebralis in fish and oligochaetesusing loop-mediated isothermal amplification. J Fish Dis 2005,28:549-557.36. El-Matbouli M, Soliman H: Development and evaluation of twomolecular diagnostic methods for detection of Thelohaniacontejeani (Microsporidia), the causative agent of porcelaindisease in crayfish. Dis Aquat Org 2006, 69:205-211.37. Soliman H, El-Matbouli M: Reverse transcription loop mediatedisothermal amplification (RT-LAMP) for rapid detection ofviral hemorrhagic septicaemia virus (VHS). Vet Microbiol 2005,114:205-213.38. Teng P, Chen C, Sung P, Lee F, Ou B, Lee P: Specific detection ofreverse transcription-loop-mediated isothermal amplifica-tion amplicons for Taura syndrome virus by colorimetricdot-blot hybridization. J Virol Methods 2007, 146:317-326.39. Boehme CC, Nabeta P, Henostroza G, Raqib R, Rahim Z, GerhardtM, Sanga E, Hoelscher M, Notomi T, Hase T, Mark D, Perkins MD:Operational feasibility of using Loop-Mediated IsothermalAmplification for diagnosis of pulmonary tuberculosis inmicroscopy centres of developing countries. J Clin Microbiol2007, 45:1936-1940.40. Davies RL: Virulence and serum-resistance in different clonalgroups and serotypes of Yersinia ruckeri. Vet Microbiol 1991,29:289-297. Page 9 of 10(page number not for citation purposes) BMC Veterinary Research 2008, 4:31http://www.biomedcentral.com/1746-6148/4/31 Publish with BioMed Central and everyscientist can read your work free of charge "BioMed Central will be the most significant development fordisseminating the results of biomedical research in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright Submit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentral41. Davies RL: Outer membrane protein profiles of Yersinia ruck-eri. Vet Microbiol 1991, 26:125-140.42. Enosawa M, Kageyama S, Sawai K, Watanabe K, Notomi T, Onoe S,Mori Y, Yokomizo Y: Use of loop-mediated isothermal amplifi-cation of the IS900 sequence for rapid detection of culturedMycobacterium avium subsp. Paratuberculosis. J Clin Microbiol2003, 9:4359-4365.43. Thai HTC, Le MQ, Vuong CD, Parida M, Minekawa H, Tsugunori N,Hasebe F, Morita K: Development and evaluation of a novelloop-mediated isothermal amplification method for rapiddetection of sever acute respiratory syndrome Coronavirus.J Gen Virol 2004, 36:93-109.44. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T: Loop-mediated isothermal amplification reaction using a nonde-naturated template. Clin Chem 2001, 47:1742-1743.45. Imai M, Ninomiya A, Minekawa H, Notomi T, Ischzaki T, Van Tu P,Tien NT, Tashiro M, Odagiri T: Rapid diagnosis of H5N1 avianinfluenza virus infection by newly developed influenza H5hemagglutinin gene-specific loop-mediated isothermalamplification method. J Virol Methods 2007, 141:173-180.46. Karleson F, Steen H, Nesland J: SYBR green I DNA stainingincreases the detection sensitivity of viruses by polymerasechain reaction. J Virol Methods 1995, 55:153-156.47. Iwamoto T, Sonobe T, Hayashi K: Loop-mediated isothermalamplification of Mycobacterium tuberculosis complex, M.avium, and M. intracellulare in sputum samples. J Clin Microbiol2003, 41:2616-2622. Page 10 of 10(page number not for citation purposes)
منابع مشابه
Synthese monofluorierter cyclopropanoider Nucleosidanaloga Synthesis of Monofluorinated Cyclopropanoid Nucleoside Analogues
Infektionskrankheiten stellen trotz der großen Erfolge in der Bekämpfung auch heute noch eine ernste gesundheitliche Bedrohung für die Menschen dar. Weltweit fallen ihnen ca. 17 Millionen Menschen jährlich zum Opfer. Impfmüdigkeit in der Bevölkerung, Ferntourismus und zunehmende Resistenz der Erreger gegen Antibiotika begünstigen die Verbreitung bekannter Infektionserkrankungen. Neue Erreger, w...
متن کاملDie IBIS-Methode - Eine RE-Methode zur Entwicklung intuitiver Nutzungsschnittstellen
Motivation Software-Hersteller, die dem wachsenden Bedarf nach intuitiv benutzbaren Produkten gerecht werden wollen, können sich einer Vielfalt von UsabilityMethoden bedienen. Gerade für kleine und mittelgroße Unternehmen (KMU) ergeben sich hier jedoch mehrere Herausforderungen. Häufig stehen nur sehr wenige Mitarbeiter zur Verfügung, die sich um die Usability der Produkte kümmern können. Diese...
متن کاملRisikomanagement im Data Warehousing: Situative Komposition einer methodischen Vorgehensweise
Data Warehousing (DWH)-Projekte sind einer Vielzahl strategischer, unternehmenspolitischer, organisatorischer und technischer Risiken ausgesetzt: Studien und Expertenbefragungen beziffern den Anteil der Projekte mit DWHBezug, die aus den verschiedensten Gründen fehlgeschlagen sind, auf 40 bis 75 Prozent. Aus diesen Zahlen lässt sich dringender Handlungsbedarf für die systematische und proaktive...
متن کاملEinsatz von Nahinfrarotspektroskopie für eine nährstoffgesteuerte Gülleausbringung
Eine pflanzenund umweltgerechte Ausbringung von Flüssigmist ist das Ziel des Projekts „Nährstoffgesteuerte Gülleausbringung“. Hierzu sollen während der Ausbringung von Flüssigmist die Inhaltsstoffe ermittelt werden und die ausgebrachte Flüssigmistmenge je nach Inhaltsstoffgehalt angepasst werden. Eine bedarfsgerechte Ausbringung wird somit realisiert. Bei dem Systemaufbau der Messtechnik wurde ...
متن کاملRole of Undecaprenyl Phosphokinase in mycobacteria: impact on biofilm formation, growth properties, persistence, and virulence
2 Zusammenfassung Die Familie der Mykobakterien setzt sich aus pathogenen und apathogenen Vertretern zusammen. In dieser Arbeit wurden 3 Mitglieder dieser Familie für Untersuchungen herangezogen: ihr prominentester pathogener Vertreter Mycobacterium tuberculosis, der Erreger der Tuberkulose, das als Impfstoff eingesetzte Mycobacterium bovis BCG, das durch Attenuierung aus dem Rindertuberkulose-...
متن کاملATLAS2000-Atlanten der Zukunft im Internet
Zusammenfassung Sehr lange war der Atlas eines der wichtigsten Hilfsmittel, um geographisches Wissen über die Erde zu sammeln und zu verbreiten. Aber in der Geographie führten neue Meßtechniken und Datenaufbereitungsmethoden zu einem immensen Aufkommen von digitalen Daten, die neue Verarbeitungsmethoden erfordern ([11]). Zur Verbesserung der Konzepte die dem Atlas zu Grunde liegen, ist es notwe...
متن کامل