DNA triple helix stabilization by aminoglycoside antibiotics.

نویسندگان

  • D P Arya
  • R L Coffee
چکیده

The stabilization of the poly(dA) x 2poly(dT) triple helix by neomycin is reported. Preliminary results indicate that neomycin stabilizes DNA triple helices and the double helical structures composed of poly(dA) x poly(dT) are virtually unaffected. This is the first report of the interaction of aminoglycoside antibiotics with DNA triple helices.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Aminoglycoside-nucleic acid interactions: remarkable stabilization of DNA and RNA triple helices by neomycin.

The stabilization of poly(dA).2poly(dT) triplex, a 22-base DNA triplex, and poly(rA).2poly(rU) triple helix by neomycin is reported. The melting temperatures, the association and dissociation kinetic parameters, and activation energies (E(on) and E(off)) for the poly(dA).2poly(dT) triplex in the presence of aminoglycosides and other triplex binding ligands were determined by UV thermal analysis...

متن کامل

Triple helix conformation-specific blinking of Cy3 in DNA.

We report that Cy3 undergoes triple helix conformation-specific blinking in DNA. Blinking patterns were affected by the stabilization of the Hoogsteen base-pair, suggesting that not only the presence but also the fluctuating behaviour of the triple helix can be monitored by the changes in the Cy3 blinking patterns.

متن کامل

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of...

متن کامل

New approaches toward recognition of nucleic acid triple helices.

A DNA duplex can be recognized sequence-specifically in the major groove by an oligodeoxynucleotide (ODN). The resulting structure is a DNA triple helix, or triplex. The scientific community has invested significant research capital in the study of DNA triplexes because of their robust potential for providing new applications, including molecular biology tools and therapeutic agents. The triple...

متن کامل

Spectroscopic studies of chimeric DNA-RNA and RNA 29-base intramolecular triple helices.

Fourier transform infrared (FTIR), UV absorption and exchangeable proton NMR spectroscopies have been used to study the formation and stability of two intramolecular pH-dependent triple helices composed by a chimeric 29mer DNA-RNA (DNA double strand and RNA third strand) or by the analogous 29mer RNA. In both cases decrease of pH induces formation of a triple helical structure containing either...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Bioorganic & medicinal chemistry letters

دوره 10 17  شماره 

صفحات  -

تاریخ انتشار 2000