Deshmane et al

The detection of biomarkers of oxidative stress in brain tissue and cerebrospinal fluid of patients with HIV-1 dementia indicates the involvement of stress pathways in the neuropathogenesis of AIDS. While the biological importance of oxidative stress on events involved in AIDS neuropathogenesis and the HIV-1 proteins responsible for oxidative stress remain to be elucidated, our results point to the activation of hypoxia-inducible factor 1 (HIF-1) upon HIV-1 infection and its elevation in brain cells of AIDS patients with dementia. HIF-1 is a transcription factor that is responsive to oxygen. Under hypoxic conditions, HIF-1α becomes stable and translocates to the nucleus where it dimerizes with ARNT and modulates gene transcription. Activation of HIF-1 can also be mediated by the HIV-1 accessory protein, Vpr. In addition, cellular events including reactive oxygen species (ROS) contribute to the induction of HIF-1α. Our results show that Vpr induces ROS by increasing H2O2 production, which can contribute to HIF-1α accumulation. Interestingly, increased levels of HIF-1α stimulated HIV-1 gene transcription through HIF-1 association with HIV-1 LTR DNA. These observations point to the existence of a positive feedback interplay between HIF-1α and Vpr and that, by inducing oxidative stress via activation of HIF-1, Vpr can induce HIV-1 gene expression and dysregulate multiple host cellular pathways. INTRODUCTION Oxidative stress (OS) is a phenomenon occurring in cells when production of oxygen radicals exceeds antioxidant capacity (1). An excess of free radicals damages essential macromolecules of the cell, leading to abnormal gene expression, disturbances in receptor activity, cell proliferation, cell death, or immune perturbation. OS is the major player in numerous human diseases such as cancer, ocular degeneration, and neurodegenerative diseases including AIDS-associated neuropathies (2). OS is involved in many aspects of HIV disease pathogenesis, including viral replication (3), inflammatory responses, decreased immune cell proliferation, loss of immune function, chronic weight loss and increased sensitivity to drug toxicity (4). Active replication of HIV in macrophages and microglia represents a reservoir for virus and an important step for HIV neuropathogenesis (5). This process leads to production of inflammatory products and free radical species (6). Because macrophages and microglia function as a long-term reservoir for HIV-1, these cells must possess a mechanism to protect themselves against the toxic effects of superoxide anions. In this regard, HIV-1 Tat has been shown to induce neuronal death via TNF-α induction and activation of the OS pathway (7, 8). In another study, injection of HIV-1 Tat in the rat striatum was shown to lead to activation of the OS pathway (9). In addition to Tat, HIV-1 gp120 protein has also been shown to cause reactive oxygen species (ROS) production in glial cells leading to neurodegeneration and apoptosis (10). Finally, in a recent study, HIV-1 Vpr protein was shown to be involved in OS pathway (11). During contact with HIV-infected macrophages or microglia, endothelial cells might contribute to their own damage as a result of the http://www.jbc.org/cgi/doi/10.1074/jbc.M809266200 The latest version is at JBC Papers in Press. Published on February 9, 2009 as Manuscript M809266200 Copyright 2009 by The American Society for Biochemistry and Molecular Biology, Inc. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Induction of HIF-1α by Vpr Deshmane et al. 2 production of ROS (12). ROS including superoxide (O2), hydrogen peroxide (H2O2), hydroxyl radical (OH), and reactive nitrogen species, such as nitric oxide (NO) and peroxynitrite (NO3) are biologically active species that are increasingly recognized to play major roles in vascular biology through redox signaling (13). Cytokines could form a pivotal link in ROSdependent pathways leading to the activation of redox-sensitive transcription factors, such as the hypoxia inducible factor 1 (HIF-1), whose upregulation determines the specificity of cellular responses to oxidative stress (14). HIF is an oxygen sensor and master regulator in unicellular and multicellular organisms (15), and is involved in the response to low oxygen levels (hypoxia), inducing changes in gene expression (16). HIF regulates glycolysis, mitochondrial oxygen consumption, erythropoiesis, angiogenesis, and cellular survival (17). HIF is a heterodimer of two basic helix-loop-helix/PAS proteins containing HIF-1α or HIF-2α and the aryl hydrocarbon nuclear translocator (ARNT or HIF1β) (18). HIF heterodimers bind to the hypoxia response element (HRE), a 5’-RCGTG-3’ consensus sequence (19). HIF-1 activation is modulated by TNF-α, ROS and nitric oxide and/or NO-derived species (NOS). ROS contributes to the accumulation and stabilization of HIF-1α (20, 21). Under hypoxic conditions, TNF-α promotes a signaling cascade, which depends on the translocation of NF-κB and leads to accumulation of HIF-1α protein (22). Finally, HIF-1α is phosphorylated (23). In this regard, HIF-1α has been shown to be a substrate for various protein kinase pathways including the mitogen-activated protein kinases (MAPKs) pathway. Viral protein R, Vpr is a highly conserved HIV-1 accessory protein, involved in viral replication, transactivation of long terminal repeat (LTR), nuclear localization of the pre-integration complex in non-dividing cells, cell cycle arrest, DNA damage and apoptosis (24-26). Vpr causes apoptosis through suppression of NF-κB activity or through rapid dissipation of the mitochondrial transmembrane potential, through its association with ANT leading to the release of cytochrome c, and activation of caspase 3 (27, 28). Finally, Vpr was recently shown to cause neuronal death through convergent pathogenic mechanisms with ensuing in vivo neurodegeneration (29). We have now identified Vpr as one of the HIV1 proteins involved in triggering free radical production. This occurs via increased production of ROS leading to HIF-1α accumulation in microglia. Accumulation of HIF-1α then upregulates the HIV1 promoter. These data reveal a new function for Vpr regarding its ability to induce oxidative stress (OS) and shed light on the balance that governs the mechanisms used by HIV-1 to activate the OS pathway, and its involvement in neuroAIDS. MATERIALS AND METHODS Plasmids. HIV-1 LTR Luciferase reporter plasmid and Vpr expression plasmid were previously described (30). CMV-HIF-1α was a gift from Dr. Steve McKnight (University of Texas Southwestern Medical Center, Dallas, TX). The HIF-1α promoter fused to Luciferase reporter plasmid was previously described (31, 32). Cell Culture, Transfection and Transduction Assays. The human microglial cell line (33) was maintained in DMEM + 10% FBS. Cells were transfected with 0.5μg of reporter plasmid (LTRLuc or HIF-1α-Luc) or co-transfected with 0.5μg of various expression cDNAs as indicated (34). Separately, the cells were transduced with adenoVpr or adeno-null. The amount of DNA used for each transfection was normalized with pcDNA3 vector plasmid. Each transfection was repeated at least three times with different plasmid preparations. Cell extracts were prepared 48h after transfection, and luciferase assays were performed (Promega, Madison, WI). Recombinant adenoviruses. Vpr cDNA (288 bp) was excised from pcDNA3-Vpr and cloned into the EcoRI and NheI sites of the adenovirus-shuttle plasmid pDC515 under the control of the murine cytomegalovirus promoter (purchased from Microbix Inc. Ontario, Canada). Adeno-Vpr recombinant shuttle containing Vpr sequence (pDC515-Vpr) was transfected into HEK-293 cells with pBHGfrt (del) E1, 3FLP, and a plasmid that provides adenovirus type-5 genome deleted in E1 and E3 genes. Plaques of recombinant adenovirus arising as a result of frt/FLP recombination were isolated, grown and purified by cesium chloride density equilibrium banding as previously described (35). Empty shuttle plasmid, pDC515, was used to construct control adenoviral vector (Adeno-null, a virus without a transgene). Adeno-Vpr or adeno-Null was used at an MOI of 5 plaques forming units per cell. [MOI= multiplicity of infection]. by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Induction of HIF-1α by Vpr Deshmane et al. 3 Hydrogen peroxide production assay. Microglia were grown in DMEM with 10% FBS and seeded in 6 well plates. Cells were transduced with adeno-null or adeno-Vpr virus at an MOI of 5 for 48h. Uninfected cells were also collected as a control. Cells were lysed by freeze and thaw method three times. Protein was measured using Biorad protein assay reagent. Equal amounts of protein were used in H2O2 assays with the Quantichrom Peroxide assay kit (DIOX-250) from Bioassay systems. The kit is designed to measure peroxide concentration in biological samples without any pretreatment. The method utilizes the chromogenic Fe xynol orange reaction, in which a purple complex formed when Fe provided in the reagent is oxidized to Fe by peroxides present in the sample. The intensity of the color, measured at 540-610nm, is an accurate measure of peroxide level in the sample. A standard curve was generated as recommended by the manufacturer using known amounts of H2O2. (Conversions: 1μM H2O2 equals 34ng/ml). Western blot. Microglia were infected with adeno-null or adeno-Vpr, or -Tat virus at an MOI of 5 at 37°C. Twenty-four hours post-infection, 30μg of cell extracts were subjected to Western blot analysis using anti-HIF-1α, -Vpr or anti-Grb2, antibodies using 1/1000 dilution. For HIF-1α detection, two different anti-HIF-1α antibodies were used. The HIF-1α antibodies were purchased either from BD Biosciences, (San Jose, CA) or from Abcam (Cambridge, MA). Interestingly and according to the manufacturer catalogue, antibody purchased from BD Biosciences detects two bands of HIF-1α, while Abcam antibody detects only one band of HIF-1α. Note that all Western blot assays were performed at least three times. RNA interference. Transient knockdown of HIF1α was performed with a HIF-1α-specific siRNA (Dharmacon Research Inc., Lafayette, CO). Twenty-four hours after cell plating, microglial cells were rinsed once with Optimem. siRNA was added at a final concentration of 50nM. Western blot was performed with protein extracts from untransfected cells or cells transfected with HIF1α specific siRNA using anti-HIF-1α antibody. For a loading control, anti-Grb2 antibody was used. Control non-targeting siRNA was also used (Dharmacon). Tissue Acquisition. Archival autopsy samples from the frontal lobe of HIV-Encephalitis cases and matching normal brain samples have been collected from the Manhattan Brain Bank at the Mount Sinai School of Medicine, New York, under Institutional Review Board (IRB) approval by Temple University Office for Human Subjects Protection. Immunohistochemistry. The tissue, which was formalin fixed and paraffin embedded, was sectioned at 5μm thickness and placed on electromagnetically charged glass slides. Sections were processed for immunohistochemistry as previously described (36). A rabbit polyclonal anti-HIF-1α antibody was utilized as primary antibody. After rinsing with PBS, sections were incubated for one hour at room temperature with biotinylated anti-rabbit secondary antibody, followed by one hour of incubation with AvidinBiotin-Peroxidase complexes (ABC Elite Kit, Vector Laboratories, Burlingame, California) and developed with Diaminobenzydine (DAB), counterstained with Hematoxylin and mounted for histological evaluation. ROS measurement. The trafficking of 2,3,4,5, 6pentafluorodihydrotetramethylfosamine (PFH2TMROS or Redox Sensor Red CC-1; Molecular Probes-Invitrogen, Carlsbad, CA) was used to detect reactive oxygen intermediates (37). Redox Sensor Red CC-1 is oxidized in the presence of O2 and H2O2. Briefly, microglial cells mock-, adnullor adeno-Vpr infected were loaded at 37°C for 20 min with 1μM of Redox Sensor Red CC-1 and a mitochondria-specific dye, MitoTracker green FM (50nM; Molecular Probes). Culture slides were washed with PBS and visualized with a Nikon fluorescence microscope (Nikon Eclipse E800) equipped with a triple-filter cube and charge-coupled device camera (Nikon DXM1200). Note that all ROS measurement experiments were performed at least three times. Chromatin Immunoprecipitation (ChIP) Assay. HeLa 3T1 (HL3T1) cells were grown overnight in 100-mm dishes to 60-70% confluency; cells were then transfected with 50 nM of siRNA-HIF-1α and/or transduced with Ad-Vpr or Ad-Null at an MOI of 5 using lipofectamine transfection reagent (Roche Applied Sciences). Plates were returned to the incubator for 40-48 h. Cells were crosslinked with formaldehyde, harvested, and ChIP was performed. For these studies, only 5 x 10 cells were used per immunoprecipitation reaction because the plasmid is present at a high copy number. The remainder of the procedure followed by gest on O cber 5, 2017 hp://w w w .jb.org/ D ow nladed from Induction of HIF-1α by Vpr Deshmane et al. 4 standard protocols for ChIP analysis, as recommended by the manufacturer (Upstate Biotechnology, address). The resulting DNA was analyzed by PCR reactions using the following HIV-LTR primers: (coding)(-120/+66) 5’ aactggtac catcgagcttgct 3’, and (non-coding) (+66/-120) 5’ ttgaggatccagcagtgggttc 3’. Antibody used in the ChIP procedure was against HIF-1α (purchased from BD Biosciences) as well as rabbit antimouse IgG. All ChIP assays were performed twice. RNA Extraction and Northern blot analysis. RNA was purified using the RNeasy kit from Ambion (Austin, TX) and used for Northern blot analysis as described previously (38). For generation of probes for Northern blot analysis, cDNA of human full length HIF-1α (~2.48 kb) or 5.8S rRNA cDNAs were labeled using a random primed labeling reaction with Klenow enzyme and α-[P]-dCTP. The Northern blot experiment was performed three times. HIV-1 infection. The human U-937 monocytic cell line was maintained in RPMI + 10% FBS, 100 units/ml penicillin, 50μg/ml streptomycin-G. Cells in log phase were infected with pNL4-3, pNL4-3 ΔVpr or JR-FL strains of HIV-1 as follows. Fifty nanograms of p24-containing virus stock were added per 1x 10 cells. Cells were incubated with virus stock in a small volume of serum-free medium for 2h at 37 ̊C. The cells were then washed twice with PBS and fresh medium containing 2% of FBS was added (500,000 cells /ml). All infection experiments were performed three times. Statistical analyses. Densitometric analyses were performed using EZQuant-Gel software (EZQuant Biology, Israel). The obtained data are expressed as the mean ± SE. Statistical analysis of parameters was performed using the one-way ANOVA test, followed by the unpaired Student’s t test, with P value less than 0.05 considered statistically significant