Rapid communication: Nucleotide sequences of two isoforms of porcine micromolar calcium-activated neutral protease 1 cDNA.
نویسندگان
چکیده
Name of Sequences. Porcine micromolar calcium-activated neutral protease 1 isoforms A and B (CAPN1A, CAPN1B) cDNA. Genus and Species. Sus scrofa (Meishan ×White Composite). Origin of Clones. Primers (mu1725 and mu1840; Smith et al., 2000) developed from the complete cDNA sequence of bovine CAPN1 (GenBank accession no. AF221129) were used to screen one embryonic and one adult pooled tissue porcine cDNA library (Fahrenkrug et al., unpublished data) by an iterative process as described (Smith et al., 1995). One full-length cDNA clone was obtained from each library. The pCAPN1A isoform was obtained from the adult tissue library, and isoform pCAPN1B was obtained from the embryonic cDNA library. Comparison with Related Species. The 2,142-bp open reading frame of pCAPN1A cDNA sequence has 94% and 92% identity with the bovine (GenBank accession no. AF221129) and human (GenBank accession no. X04366) sequences, respectively. Conceptual translation predicts a protein of 714 amino acids with 96% and 95% identity to bovine and human proteins, respectively. The pCAPN1B cDNA sequence has a 1,941-bp open reading frame that is 100% identical to the first 1,941 bases of the pCAPN1A cDNA. Sequence Data. The truncated reading frame of pCAPN1B results from a 496-bp insertion into the sequence of pCAPN1A, which introduces a stop codon immediately after the site of insertion. Following the inserted sequence, the sequence of pCAPN1B is identical to the remainder of pCAPN1A throughout the coding region and the 3′untranslated region (3′UTR). The position of the insertion is identical to the boundary between exon 17 and exon 18 of the bovine CAPN1 gene (Smith et al., 2000). Therefore we tested the possibility that the insertion resulted from a retained intron, using primers (mu1896 and mu2239; Smith et al., 2000) that flank intron 17 and 18 of the bovine gene. These primers were used to amplify the corresponding region from a Bacterial Artificial Chromosome clone containing the
منابع مشابه
Nucleotide sequence of cDNA encoding for preprochymosin in native goat (Capra hircus) from Iran
Prochymosin is one of the most important aspartic proteinases used as a milk-clotting enzyme in cheese production. In the present investigation we report sequence of cDNA encoding goat ( Capra hircus ) preprochymosin and compare its nucleotide and deduced amino acid sequences with sequences of other ruminants preprochymosin. As bovine prochymosin, the caprine prochymosin cDNA encodes 365 amino ...
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملCloning, expression, and polymorphism of the porcine calpain10 gene.
Calpains are calcium-regulated proteases involved in cellular functions that include muscle proteolysis both ante- and post-mortem. This study was designed to clone the complete coding sequence of the porcine calpain10 gene, CAPN10, to analyze its expression characteristics and to investigate its polymorphism. Two isoforms of the CAPN10 gene, CAPN10A and CAPN10B, were obtained by reverse transc...
متن کاملChannel properties of the splicing isoforms of the olfactory calcium-activated chloride channel Anoctamin 2
Anoctamin (ANO)2 (or TMEM16B) forms a cell membrane Ca(2+)-activated Cl(-) channel that is present in cilia of olfactory receptor neurons, vomeronasal microvilli, and photoreceptor synaptic terminals. Alternative splicing of Ano2 transcripts generates multiple variants with the olfactory variants skipping exon 14 and having alternative splicing of exon 4. In the present study, 5' rapid amplific...
متن کاملPurification, cDNA cloning, and recombinant expression of chymotrypsin C from porcine pancreas.
Chymotrypsin C is a bifunctional secretory-type serine protease in pancreas; besides proteolytical activity, it also exhibits a calcium-decreasing activity in serum. In this study, we purified activated chymotrypsin C from porcine pancreas, and identified its three active forms. Active chymotrypsin C was found to be different in the length of its 13-residue activation peptide due to carboxydipe...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of animal science
دوره 79 2 شماره
صفحات -
تاریخ انتشار 2001