Cancer Therapy: Preclinical The Notch Target Hes1 Directly Modulates Gli1 Expression and Hedgehog Signaling: A Potential Mechanism of Therapeutic Resistance

Purpose: Multiple developmental pathways including Notch, Hedgehog, and Wnt are active in malignant brain tumors such as medulloblastoma and glioblastoma (GBM). This raises the possibility that tumors might compensate for therapy directed against one pathway by upregulating a different one. We investigated whether brain tumors show resistance to therapies against Notch, and whether targeting multiple pathways simultaneously would kill brain tumor cells more effectively than monotherapy. Experimental Design: We used GBM neurosphere lines to investigate the effects of a gamma-secretase inhibitor (MRK-003) on tumor growth, and chromatin immunoprecipitation to study the regulation of other genes by Notch targets. We also evaluated the effect of combined therapy with a Hedgehog inhibitor (cyclopamine) in GBM and medulloblastoma lines, and in primary human GBM cultures. Results: GBM cells are at least partially resistant to long-term MRK-003 treatment, despite ongoing Notch pathway suppression, and show concomitant upregulation of Wnt and Hedgehog activity. The Notch target Hes1, a repressive transcription factor, bound the Gli1 first intron, and may inhibit its expression. Similar results were observed in a melanoma-derived cell line. Targeting Notch and Hedgehog simultaneously induced apoptosis, decreased cell growth, and inhibited colony-forming ability more dramatically than monotherapy. Low-passage neurospheres isolated from freshly resected human GBMs were also highly susceptible to coinhibition of the two pathways, indicating that targeting multiple developmental pathways can be more effective than monotherapy at eliminating GBM-derived cells. Conclusions: Notch may directly suppress Hedgehog via Hes1 mediated inhibition of Gli1 transcription, and targeting both pathways simultaneously may be more effective at eliminating GBMs cells. Clin Cancer Res; 16(24); 6060–70. 2010 AACR. Glioblastoma (GBM) is the most common malignant primary central nervous system tumor in adults and is characterized by resistance to chemoand radiotherapy (1). Prognosis remains very poor, with most patients surviving less than 2 years (2) despite recent advances in surgery and chemotherapy. It has become clear that GBMs are a diverse group of tumors, with different subtypes activating distinct sets of oncogenes and signaling pathways (3). Because of this, no single therapy is likely to be effective against all GBMs, and a number of pharmacologic agents with activity against specific targets such as epidermal growth factor receptor (EGFR), Akt, Hedgehog, mammalian target of rapamycin (mTOR), phosphoinositide 3kinase, platelet-derived growth factor receptor (PDGFR), Raf, and transforming growth factor b (TGF-b), are being developed (4). However, even the use of targeted therapies can be limited by the emergence of resistant tumor cells, and resistance to EGFR inhibitors (5) and Hedgehog inhibitors (6) has already been documented. An important developmental pathway required in at least a subset of GBMs is Notch. Aberrant Notch signaling was implicated in the initiation of T-cell lymphoblastic leukemia in the early 1990s (7), and has since been demonstrated in many different hematopoietic and epithelial tumors (8–10). Upregulation of Notch pathway components has been demonstrated in GBM (11–13) and the malignant embryonal tumor medulloblastoma (14, 15), and Notch pathway inhibition has emerged as a potential therapy for malignant brain tumors. The 4 Notch receptors (Notch 1–4) bind ligands (Jagged and Delta) expressed on adjacent cells, permitting cleavage of Notch via ADAM Authors' Affiliations: Departments of Neuroscience, Pathology, Neurology, and Oncology, Institute for Cell Engineering, Johns Hopkins University School of Medicine, Baltimore, Maryland; and University of Texas MD Anderson Cancer Center, Houston, Texas Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). Corresponding Author: Charles G. Eberhart, Johns Hopkins University School of Medicine, Ross Building 558, 720 Rutland Ave., Baltimore, MD 21205. Phone: 410-502-5185; Fax: 410-955-9777; E-mail: [email protected] doi: 10.1158/1078-0432.CCR-10-1624 2010 American Association for Cancer Research. Clinical Cancer Research Clin Cancer Res; 16(24) December 15, 2010 6060 on August 15, 2017. © 2010 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from metalloprotease and then gamma-secretase (16). The released intracellular domain (ICD) of Notch translocates to the nucleus, where it binds CBF-1/RBP-J and promotes transcription of the Hes/Hey genes that help maintain a progenitor-like state by repressing transcription of prodifferentiation genes during development (17, 18). Many different techniques for Notch blockade have been attempted, including gamma-secretase inhibitors (GSI; ref. 19), siRNA (12), monoclonal antibodies (20–22), and small inhibitory molecules directly affecting the transcriptional complex (23). SiRNA and GSIs have been tested in the context of malignant brain tumors (12, 13, 19, 24) with promising results in vitro and in xenograft models. More than 20 phase I/II clinical trials investigating the efficacy of GSIs in tumors are actively recruiting or awaiting activation (www.clinicaltrials.gov), but it is uncertain whether inhibition of Notch signaling alone will be sufficient to prevent tumor growth as cancer adaptation is well documented. We assessed the effects of Notch inhibition on malignant brain tumor cells and the potential emergence of therapeutic resistance. Some GBM neurosphere lines that survived long-term Notch inhibition upregulated Wnt and Hedgehog, with the latter effect due potentially to Hes1 binding and inhibiting Gli1 at the transcriptional level. We found that inhibiting Notch and Hedgehog simultaneously dramatically decreased growth of neurosphere cultures and primary human GBM cells, suggesting this regulatory mechanism may contribute to resistance. Materials and Methods Cell culture DAOY, PFSK, U87, 22RV1, H157, KMS12, L428, Mel10, Reh, TOV-112D, and U937 were maintained in the recommended media with 10% fetal bovine serum (FBS) unless otherwise specified. HSR-GBM1 and HSR-GBM2 were maintained as neurosphere cultures in serum-free neurosphere media (25). Cell line identity was verified using SNP analysis. For all assays, cells were counted using GUAVA Viacount reagent according to the manufacturer’s instructions (Millipore) and equal numbers of viable cells were used for all experiments. For drug treatment assays, adherent cell lines were plated overnight in 6or 96-well plates (BD Falcon; BD Biosciences) with media containing 10% FBS. The next day media was changed to low serum (0.5% FBS) and MRK-003 (26), cyclopamine (Infinity Pharmaceuticals), or vehicle (DMSO or ethanol, respectively) was added to each well as specified. Media was changed to every 2 to 3 days as necessary. For neurosphere lines, cells were treated immediately on plating with drugs as specified. Cell biomass was measured using CellTiter96 (Promega) at regular intervals after treatment. Anchorage-independent growth assays measuring colony-forming ability were performed as previously described (19). Colonies were stained and counted 21 to 28 days after plating. Neurosphere nucleofection assays were performed using the AMAXA Mouse NSC Nucleofector Kit (Lonza) according to the manufacturer’s instructions, using program A033 with 2 10 cells per condition. Cells were nucleofected with Hes1 (27) or a control plasmid and allowed to recover for 24 hours in normal media before treatment with MRK-003 or vehicle. Transfection efficiency was quantified by cotransfection with CAG-green fluorescent protein (GFP) and microscopic quantification of the percentage of GFP-expressing cells. Cells were harvested after 48 hours for analysis. Notch2 overexpression was achieved by incubating 4 10 dissociated cells in a 12-well plate with neurosphere media and 8 mg/mL Polybrene (Sigma-Aldrich). Concentrated retrovirus designed to express Notch2 ICD with a truncated PEST domain (aa1703-2146) was added to the cells and the dish was rotated every 20 minutes for 2 hours, and 2 mL media was added to the cells. Cells were harvested 48 hours later. In some assays, infected cells were treated with MRK-003 24 hours after infection and were harvested 48 hours later. shRNAs Lentivirus was produced as previously described (28) from shRNA constructs against human Notch1 (TRCN0000003359 and TRCN0000003360) and Notch2 (TRCN0000004895 and TRCN0000004896). Neurosphere lines were infected as described earlier in the text. Cells were harvested 72 hours after infection, RNA was isolated, and target levels were assayed by quantitative PCR (qPCR). Primary tumor-derived cell culture JHH-GBM4, JHH-GBM10, JHH-GBM11, JHH-GBM14, JHH-GBM17, JHH-GBM18, JHH-GBM20, and JHHGBM23 were generated from primary GBM surgical Translational Relevance The emergence of therapeutic resistance is a significant concern when targeting many signaling pathways and tumor types. We found that in vitro Notch pathway blockade in glioblastoma (GBM) cells using a gammasecretase inhibitor (GSI) led to increased activity in two other pathways important for neural development— Wnt and Hedgehog. The Notch target Hes1, a transcriptional repressor, can directly bind the first Gli1 intron, suggesting a mechanism by which Notch can inhibit Hedgehog activity. Inhibition of both Notch and Hedgehog in vitro dramatically decreased the growth of GBM cell lines and low-passage neurospheres derived from primary human tumors. These findings demonstrate that Notch-targeted therapeutics can lead to alterations in other developmental signaling cascades that promote tumor survival, and suggest that combined treatment with Hedgehog pathway inhibitors may be able to increase the efficacy of GSIs in some cancer patients. Hes1 Modulates Gli1 in Glioblastoma www.aacrjournals.org Clin Cancer Res; 16(24) December 15, 2010 6061 on August 15, 2017. © 2010 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from specimens at Johns Hopkins Hospital (Baltimore, MD) as previously described (25, 28). JHH-GBM4, JHH-GBM17, JHH-GBM18, JHH-GBM20, and JHH-GBM23 were used as primaryor very low-passage cultures (passage0–2),whereas JHH-GBM10 and JHH-GBM11 were analyzed at passage 12–20. JHH-GBM14 was used both as a primary culture and at later passages (10–15) as indicated in the text. Quantitative PCR RNA was extracted using an RNeasy kit (Qiagen) with oncolumn DNase treatment (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed, and qPCR was done using SYBR Green PCR Master Mix (Applied Biosystems) on an I-Cycler IQ Real-Time detection system (Bio-Rad) according to themanufacturer’s instructions. Thefollowingprimerswereobtainedfrompublishedliterature: hGli1, hPtc1B, and b-actin (29). hHes1, hHes5, hHey1, and hHey2 primers were designed using Primer3 (30) hHes1: forward (F) 50-AGTGAAGCACCTCCGGAAC-30, reverse (R) 50-TCACCTCGTTCATGCACTC-30; hHes5: forward (F) 50-CCGGTGGTGGAGAAGATG-30, reverse (R) 50-TAGTCCTGGTGCAGGCTCTT-30. hAxin2 primers were a generous gift from Brian Simons (Johns Hopkins University, Department of Pathology): forward (F) 50CTGGTGGCTGGTGCAAAGAC30, reverse (R) 50-CGAGTGTGAGGTCCACGGAA-30. The standard curve technique was used to determine expression levels and values were normalized to b-actin. Protein analysis Protein was extracted from cell pellets using RIPA buffer (R0278, Sigma-Aldrich) and 30 mg of this was run on each lane of a NuPage 4% to 12% Bis-Tris gel (Invitrogen) according to the manufacturer’s instructions. The antibodies used were as follows: rabbit anti-Hes1 (1:400, AVIVA Systems Biology, 1:1,000, Toray Industries) rabbit monoclonal anti-Cleaved Notch1 (Cell Signaling), and mouse monoclonal anti-GAPDH (1:50,000, Research Diagnostics Inc.). Chromatin immunoprecipitation Chromatin Immunoprecipitation (ChIP) was performed using 2 different techniques and antibodies. For the Magna ChIP kit (Millipore), cells were grown in the appropriate media, harvested during log-phase growth, cross-linked using 1% formaldehyde, and processed according to the manufacturer’s instructions. The positive control was antiAcetyl Histone H3, negative control was rabbit IgG, and Rabbit anti-Hes1 was used for pulldown (AVIVA Systems Biology). Nonquantitative PCR was performed using the primers in Supplementary Table S1. GAPDH and Hes1 primer sets were used as negative and positive controls, respectively, as Hes1 has previously been shown to bind its own promoter (31, 32). Some samples were run using qPCR as well. The other technique used for ChIP has been previously described (33). Briefly, cells were grown in the appropriate media, harvested during log-phase growth, and cross-linked with formaldehyde. Hes1 antibody (5 mg;Millipore) or 5 mg control (rabbit IgG)was added to the sample and incubated for 12 hours at 4 C. After washing, cross-linking was reversed and qPCR was performed as described earlier in the text using the primers in Table 1. p63 andp27Kip primer sets were used as negative and positive controls, respectively (34). Linear amplification of each primer set used for qPCR was verified by a standard curve. qPCR calculations were done as previously described (35). Briefly, the average of the cycle threshold values (CT) was calculated for each input, sample, and control. The input CT was subtracted from the corresponding sample and control CTs. The following formula was then applied: power [1.9, negative ln (subtracted value)]. This value was used for further calculations. Each sample and control was normalized by dividing both numbers by the highest value so that each ChIP experiment was scaled from 0 to 1 and outliers were removed. For sample minus control values, a negative number was replaced with a zero. Gene expression analysis Gene expression was measured using Agilent’s 44K whole human genome microarrays at the Johns Hopkins Oncology Microarray Core, with labeling, hybridization, and detection performed according to the manufacturer’s instructions (Agilent Technologies). Differential gene expression, gene set enrichment analyses, and Analysis of Functional Annotation were performed as previously described (36, 37), using statistical packages from the R/Bioconductor project (38, 39). Gene annotation for the microarray used in this study was obtained from the corresponding R/Bioconductor metadata packages. Raw expression data along with MIAME (Minimal Information about a Microarray Experiment) required information are located in the GEO database (40). Table 1. Top differentially expressed genes in microarray Notch pathway Up: CCND1, CREBBP, DLL1, DLL3, ELAVL4, IGF1R, KLF4, TFRC, Down: EFEMP1, HES1, HES5, HEY1, HEY2, HOXA5, HOXA7, HOXA9, Wnt pathway Up: CCND1, CREBBP, NRFA1, SFRP1, WNT5B, WNT7A, Down: ERBB2, FRZB, FZD8, TCF7L1 Hedgehog pathway Up: MYCN, GLI2, NR4A1, Down: GLI1, GLI3, SUFU, Other pathways Up: ABCA1, VEGFA Down: HOXA4, HOXC9, PDPN, PDGFRA, RB1, S100B, TGFB1, NOTE: Genes altered in "Top 100" gene list are given in bold. Schreck et al. Clin Cancer Res; 16(24) December 15, 2010 Clinical Cancer Research 6062 on August 15, 2017. © 2010 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from