The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
نویسندگان
چکیده
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.
منابع مشابه
Mycoplasma mycoides subsp. capri and Mycoplasma mycoides subsp. mycoides LC can be grouped into a single subspecies.
Mycoplasma mycoides subsp. capri and Mycoplasma mycoides subsp. mycoides LC can be combined into one taxon on the basis of several contributions on both DNA sequence and protein analyses reported in the literature. Moreover, for the differentiation and identification of mycoplasmas of the "mycoides cluster", we investigated the rpoB gene, encoding the beta-subunit of the RNA polymerase. A segme...
متن کاملGenetic and serological analysis of lipoprotein LppA in Mycoplasma mycoides subsp. mycoides LC and Mycoplasma mycoides subsp. capri.
The genes encoding the 62-kDa lipoproteins from the Mycoplasma mycoides subsp. mycoides large-colony type (LC) strain Y-goat and the M. mycoides subsp. capri strain PG3 were cloned and analyzed by sequencing. These two lipoproteins have been named LppA[MmymyLC] and LppA[Mmyca], and their corresponding genes have been named lppA[MmymyLC] and lppA[Mmyca], respectively. The nucleotide and deduced ...
متن کاملUnconventional codon reading by Mycoplasma mycoides tRNAs as revealed by partial sequence analysis.
Continuing our investigation of the tRNA genes and gene products in Mycoplasma mycoides, we report the sequence of the gene for tRNALeu (CAA) as well as partial primary structures of the following tRNAs: Leu (CAA), Leu (UAG), Arg (UCU), Thr (AGU) and Ile (CAU). It is suggested that in M. mycoides, at least some of the family codon boxes are read by only one tRNA each, using an unconventional me...
متن کاملCloning and nucleotide sequence analysis of transfer RNA genes from Mycoplasma mycoides.
As part of an investigation of the tRNA genes of Mycoplasma mycoides, two HindIII fragments of mycoplasma DNA comprising 0.4 and 2.5 kilobases (kb), respectively, were cloned in pBR322 and their nucleotide sequences determined. Only one tRNA gene was found in the 0.4 kb fragment, the gene for tRNAArg with the anticodon TCT, while the 2.5 kb fragment contained nine different tRNA genes arranged ...
متن کاملKinetics of substrate oxidation and hydrogen peroxide production by Mycoplasma mycoides subsp. mycoides Large Colony (LC) type and Mycoplasma mycoides subsp. capri.
Mycoplasma mycoides subsp. mycoides Large Colony (LC) type is a pathogen of goats causing contagious agalactia and respiratory disease, found on all continents where small ruminants are kept. It shares close genetic characteristics with M. mycoides subsp. capri. Substrate oxidation by 22 strains of M. mycoides subsp. mycoides LC from nine countries was compared with that of eight strains of M. ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Nucleic acids research
دوره 8 12 شماره
صفحات -
تاریخ انتشار 1980