Development of a Pefloxacin Disk Diffusion Method for Detection of 1 Fluoroquinolone - resistant Salmonella

19 Fluoroquinolones are among the drugs of choice for treatment of salmonella infections. However, 20 fluroquinolone resistance is increasing in salmonella due to chromosomal mutations in the quinolone 21 resistance-determining region (QRDR) of the topoisomerase genes gyrA, gyrB, parC and parE and/or plasmid22 mediated quinolone resistance (PMQR) mechanisms including qnr variants, aac(6’)-Ib-cr, qepA and oqxAB. 23 Some of these cause only subtle increases of the MIC i.e, MICs ranging from 0.12 – 0.25 mg/L for ciprofloxacin 24 (just above the wild type MIC of ≤0.06 mg/L). These isolates are difficult to detect with standard ciprofloxacin 25 disk diffusion, and plasmid mediated resistance such as qnr are often not detected by the nalidixic acid screen 26 test. We evaluated 16 quinolone/fluoroquinolone disks for their ability to detect low-level resistant Salmonella 27 non-typhi isolates. A total of 153 Salmonella isolates characterized for the presence (N=104) or absence (N=49) 28 of gyrA/parC topoisomerase mutations, qnrA, qnrB, qnrD, qnrS, aac(6’)-lb-cr or qepA genes were investigated. 29 All isolates were MIC tested by broth micro-dilution against ciprofloxacin, levofloxacin and ofloxacin and by 30 disk diffusion using EUCAST/CLSI methodology. MIC determination correctly categorized all isolates as either 31 wildtype (MICs ≤0.06 mg/L and absence of resistance genes) or non-wildtype (MIC >0.06 mg/L and presence of 32 a resistance gene). Disk diffusion using these antibiotics and nalidixic acid failed to detect some low-level resistant 33 isolates whereas the pefloxacin 5 μg disk correctly identified all resistant isolates. However, pefloxacin will not 34 detect isolates having aac(6’)-Ib-cr as the only resistance determinant. The pefloxacin disk assay was approved 35 and implemented by EUCAST(2014) and CLSI(2015). 36 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom Introduction 37 Human infections caused by Salmonella enterica subspecies enterica represent a major burden worldwide (1). 38 Typhoidal Salmonella (Salmonella Typhi and Paratyphi A) cause enteric fever, a severe systemic and febrile 39 illness, whereas non-typhoidal serotypes primarily cause self-limiting diarrhoea with occasional bacteraemia. 40 Timely treatment with antimicrobial agents is critical for optimal treatment of both enteric fever and invasive 41 non-typhoidal Salmonella infections. Fluoroquinolones (e.g. ciprofloxacin) are highly efficient against fully 42 susceptible (i.e. isolates without any resistance mechanisms) whereas their efficacy is in doubt as soon as any 43 resistance can be detected and there is concern about the rapidly increasing fluoroquinolone resistance in 44 Salmonella (2-5). 45 Fluoroquinolone resistance in Salmonella is mainly caused by chromosomal mutations in the 46 quinolone resistance-determining region (QRDR) of the topoisomerase genes gyrA, gyrB, parC and parE (6,7). 47 These mutations usually confer stepwise resistance; a single mutation is associated with a ciprofloxacin 48 minimum inhibitory concentration (MIC) of 0.12-0.5 mg/L whereas two or more mutations result in higher MIC 49 values. Topoisomerase mutations are associated with resistance to the quinolone nalidixic acid (MIC >16 mg/L) 50 (6). 51 In addition to the QRDR topoisomerase mutations, a number of plasmid-mediated quinolone 52 resistance (PMQR) mechanisms have been described including qnr variants, aac(6’)-Ib-cr, qepA and oqxAB, with 53 qnr genes being the predominant PMQR mechanism among Salmonella (7,8). 54 The PMQR mechanisms result in reduced susceptibility to ciprofloxacin (MIC 0.125-1.0 mg/L) but only a modest 55 or no increase in nalidixic acid (MIC 8-32mg/L) (8). Although the PMQR mechanisms only confer a moderate 56 increase in fluoroquinolone MICs, they are clinically relevant; patients infected with both Salmonella Typhi and 57 non-typhoidal Salmonella isolates with ciprofloxacin MICs of 0.125-1.0 mg/L have more treatment failures and 58 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom longer times to fever clearance than patients with isolates fully susceptible to ciprofloxacin (MIC ≤ 0.06 mg/L) 59 (2, 9-11). 60 Since Salmonella isolates with low-level fluoroquinolone resistance may be associated with 61 failed response to fluoroquinolone treatment, it is important that these isolates are detected during routine 62 antimicrobial susceptibility testing. This has been recognized by the Clinical and Laboratory Standards Institute 63 (CLSI) and the European Committee on Antimicrobial Susceptibility Testing (EUCAST), the two international 64 bodies providing antimicrobial susceptibility testing guidelines. Initially, both EUCAST and CLSI included 65 warnings for using fluoroquinolones for treating infections caused by Salmonella spp. with ciprofloxacin MICs > 66 0.06 mg/L and later both organizations introduced species-specific MIC breakpoints for Salmonella and 67 fluoroquinolones to aid in the detection of isolates with acquired resistance (12-14). 68 For laboratories using disk diffusion, detection of low-level resistant isolates is challenging. With 69 ciprofloxacin, an overlap in inhibition zone diameters between wild type isolates and isolates with low-level 70 resistance has been reported for the 5 μg disk (15-17). For many years, both CLSI and EUCAST therefore 71 recommended the use of a nalidixic acid disk as a screening test. However, this does not adequately detect 72 isolates with PMQR, which are often susceptible to nalidixic acid (MIC ≤16 mg/L) (8). 73 The aim of this study was to investigate whether or not one of 16 evaluated fluoroquinolone 74 disks could identify all known fluoroquinolone resistance mechanisms in Salmonella isolates. 75 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom Materials and Methods 76 Bacterial isolates 77 A total of 153 non-typhoidal Salmonella isolates were included, 98 from Statens Serum Institut (SSI), 78 Copenhagen, Denmark and 55 through the National Antimicrobial Resistance Monitoring System (NARMS) at 79 the Centers for Disease Control and Prevention (CDC), Atlanta, USA (Supplementary table 1). To ensure a high 80 proportion of isolates exhibiting difficult-to-detect low-level fluoroquinolone resistance, the collection 81 consisted of 104 isolates with ciprofloxacin MICs in the range of 0.125-0.5 mg/L and 49 isolates fully susceptible 82 to nalidixic acid and ciprofloxacin (MIC ≤0.064 mg/L). Serotype distribution was very similar in the two 83 materials. 84 85 DNA isolation, PCR amplification and Sequencing 86 All 153 isolates were investigated for the presence of gyrA/parC topoisomerase mutations, qnrA, qnrB, qnrD, 87 qnrS, aac(6’)-lb-cr, and qepA genes. For each isolate, crude genomic DNA was prepared by lysing the bacteria at 88 95°C for 10 minutes and collecting the supernatant after a brief centrifugation. The presence of these genes 89 and mutations were investigated by PCR and Sanger sequencing using the following primer pairs (5’ to 3 ́); parC 90 (CTATGCGATGTCAGAGCTGG, TAACAGCAGCTCGGCGTATT) (18), gyrA 91 (ATGAGCGACCTTGCGAGAGAAATTACACCG, TTCCATCAGCCCTTCAATGCTGATGTCTTC) (19), qnrA 92 (GGATGCCAGTTTCGAGGA, TGCCAGGCACAGATCTTG) (20), qnrB (GGMATHGAAATTCGCCACTG, 93 TTTGCYGYYCGCCAGTCGAA) (21), qnrD (CGAGATCAATTTACGGGGAATA, AACAAGCTGAAGCGCCTG) (22), qnrS 94 (TCGACGTGCTAACTTGCG, GATCTAAACCGTCGAGTTCGG) (20), aac(6’)-Ib-cr (TTGCGATGCTCTATGAGTGGCTA, 95 CTCGAATGCCTGGCGTGTTT) (23), and qepA (TGGTCTACGCCATGGACCTCA, TGAATTCGGACACCGTCTCCG) (24). 96 Each PCR was performed in a 100 μl volume using AmpliTaq (Perkin Elmer, Waltham, MA, USA) on a GeneAmp 97 PCR System 2400 (Perkin Elmer). Amplicons were purified using QIAquick PCR Purification Kit (QIAGEN, 98 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom Valencia, CA, USA) according to the manufacturer’s instructions, and subsequently sequenced on an ABI PRISM 99 373 DNA Sequencer (PE Applied Biosystems, Foster City, CA, USA). 100 101 Antimicrobial Susceptibility Testing 102 MICs for ciprofloxacin, levofloxacin, nalidixic acid and ofloxacin were determined using broth microdilution 103 (BMD) according to the ISO standard 20776-1. Testing was performed using customized frozen (TREK 104 Diagnostics/Thermo Fisher Scientific, Oakwood, OH) or lyophilized (TREK Diagnostics/Thermo Fisher Scientific, 105 Basingstoke, United Kingdom) panels. 106 Disk diffusion (DD) was performed according to EUCAST and CLSI methodology i.e. Mueller 107 Hinton (MH) agar medium, inoculum of 0.5 McFarland taken from fresh overnight cultures and incubation for 108 16-20 hours at 35°C in ambient air (25,26). 109 E. coli ATCC 25922 was used as quality control strain in all assays. 110 111 Identification of candidate disks suitable for screening for fluoroquinolone resistance 112 Sixteen Fluoroquinolone and quinolone disks (Table 1) were evaluated for their ability to detect low-level 113 fluoroquinolone resistance in Salmonella enterica. This work was performed at the EUCAST Development 114 Laboratory Växjö, Sweden (EDL) and at the Reference Laboratory for Antibiotic Resistance at Statens Serum 115 Institut (SSI), Copenhagen, Denmark. For this evaluation, 87 of the 153 isolates were included and tested on 116 two brands of Mueller-Hinton (MH) media (BBL, Becton Dickinson, Baltimore, US and Oxoid, Thermo Fisher 117 Scientific, Basingstoke, United Kingdom). All tests were read by two persons, giving four readings per isolate, 118 i.e. a total of 87 isolates x 2 media x 2 persons = 348 readings per disk. Four disks were included in a second 119 round of testing (ciprofloxacin 1 μg, enoxacin 10 μg, norfloxacin 2 μg and pefloxacin 5 μg) along with 120 ciprofloxacin (5 μg), nalidixic acid (30 μg), levofloxacin (5 μg), and ofloxacin (5 μg) disks. This second evaluation 121 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom was performed at three laboratories (EDL, SSI and NARMS-CDC) and included 126 isolates (Table 2). All three 122 sites used the same lots of disks and performed testing on two different types of MH media using commercial 123 BBL Mueller-Hinton agar plates (Becton Dickinson) as common media. In addition, NARMS-CDC used 124 commercial plates from Remel (Thermo Fisher Scientific, Waltham, MA, USA), EDL used in-house prepared 125 plates based on Mueller-Hinton powder from Oxoid and SSI used in-house prepared plates based on BBL MH 126 powder from Becton Dickinson. Altogether, this resulted in 126 isolates x 3 laboratories x 2 media = 756 127 readings for each disk. The purpose of using different brands of media and different readers were to 128 investigate the robustness of the method by simulating the everyday situation where media from different 129 manufacturers would be used in many laboratories and where results would depend on the acuity of many 130 readers. The results were therefore interpreted collectively rather than by individual media and reader. 131 132 Validation of the pefloxacin 5 μg disk 133 Once we had chosen to develop the method on the pefloxacin disk, two steps were taken to validate the disk 134 diffusion assay. As a first step, differences in pefloxacin disk potency among disks from different manufacturers 135 was assessed by testing 24 selected isolates against pefloxacin 5 μg disks from Becton Dickinson, Bio-Rad 136 (Marnes-la-Coquette, France), MAST Diagnostic (Bootle,Merseyside, UK) and Oxoid. The disk potency was 137 investigated independently at two sites using a bioassay (27). 138 Secondly, pefloxacin 5 μg disks (Oxoid) were evaluated on consecutive clinical isolates as part of 139 the routine disk diffusion testing at the department of Clinical Microbiology, Kronoberg and Blekinge counties, 140 Sweden, alternating between Mueller-Hinton agar from BD, Bio-Rad and Oxoid and ten different readers. 141 on O cber 6, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom Results 142 A fluoroquinolone resistance mechanism was identified in all 104 ciprofloxacin non-wild type isolates 143 (ciprofloxacin MIC >0.06 mg/L); 53 harboured a topoisomerase mutation in gyrA, 50 harboured a qnr gene and 144 a single isolate harboured the aac(6)’lb-cr gene. The corresponding MIC values for levofloxacin were >0.125 145 mg/L and for ofloxacin >0.125 mg/L while for nalidixic acid, isolates with a topoisomerase mutation all 146 displayed nalidixic MIC of >16 mg/L whereas isolates with a plasmid-mediated mechanism exhibited MIC values 147 of 4->64 mg/L (Supplementary table 1). 148 In the 49 isolates with ciprofloxacin MICs ≤0.06 mg/L, there were no fluoroquinolone resistance 149 mechanisms (gyrA/parC, qnr, qep or aac(6)’lb-cr genes). The corresponding MIC values were ≤0.125 mg/L for 150 levofloxacin and ofloxacin and ≤16 mg/L for nalidixic acid. Thus, with standardized broth micro dilution MIC 151 determination, ciprofloxacin, levofloxacin and ofloxacin, accurately and equally well, categorized the 49 152 isolates as belonging to the wild type. 153 For E. coli ATCC 25922, all MIC values for ciprofloxacin (N=23), levofloxacin (N=13), ofloxacin 154 (N=18) and nalidixic acid (N= 18) were within the established QC ranges (13,28). 155