Autochthonous Leishmania siamensis in Horse, Florida, USA

نویسندگان

  • Sarah M. Reuss
  • Mark D. Dunbar
  • Maron B. Calderwood Mays
  • Jennifer L. Owen
  • Martha F. Mallicote
  • Linda L. Archer
  • James F.X. Wellehan
چکیده

Horse FL ATTACA-CCAAAAAACATACAGG-TAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Bovine|GQ281282 ATTACA-CCAAAAAACATACAGGCTAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Horse|GQ281281 ATTACA-CCAAAAAACATACAGGCTAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Human|JQ001751 ATTACA-CCAAAAAACATACAGG-TAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Human|JQ001752 ATTACA-CCAAAAAACATACAGG-TAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Human|GQ293226 ATTACA-CCAAAAAACATACAGG-TAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Human|GQ226034 ATTACA-CCAAAAAACATACAGG-TAGAGA-GTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCG-ATATGCCTTTCCCACATACACAAACACAGCAATATATATGT Human ref|EF200012 ATTACACCCAAAAAACATACAGG-TAGAGAGGTAGTAGAATACATCTACTCGGGGAGGCATGTTTTTTCCGTATATGCCTTTCCCACATACACAAACACAGCAATATATATGT

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Autochthonous disseminated dermal and visceral leishmaniasis in an AIDS patient, southern Thailand, caused by Leishmania siamensis.

We report the first establishment of in vitro cultivation and genotypic characterization of Leishmania siamensis isolated from an autochthonous disseminated dermal and visceral leishmaniasis in a Thai acquired immunodeficiency syndrome (AIDS) patient. The molecular identification has shown that the parasite was identical to L. siamensis, a recently described Leishmania species reported in the s...

متن کامل

Disseminated Dermal Leishmaniasis Caused by Leishmania siamensis In a Systemic Steroid Therapy Patient

Leishmania siamensis infection was recently reported from Thailand. Clinical presentation of L. siamensis infections is generally related to human immunodeficiency virus infection. Herein, disseminated dermal L. siamensis infection in a systemic steroid therapy patient from Myanmar is described.

متن کامل

Visceral Leishmaniasis in Traveler to Guyana Caused by Leishmania siamensis, London, UK

The parasite Leishmania siamensis is a zoonotic agent of leishmaniasis; infection in animals has been documented in Europe and the United States. Reported authochthonous human infections have been limited to Thailand. We report a case of human visceral Leishmania siamensis infection acquired in Guyana, suggesting colonization in South America.

متن کامل

First Isolation of Leishmania from Northern Thailand: Case Report, Identification as Leishmania martiniquensis and Phylogenetic Position within the Leishmania enriettii Complex

Since 1996, there have been several case reports of autochthonous visceral leishmaniasis in Thailand. Here we report a case in a 52-year-old Thai male from northern Thailand, who presented with subacute fever, huge splenomegaly and pancytopenia. Bone marrow aspiration revealed numerous amastigotes within macrophages. Isolation of Leishmania LSCM1 into culture and DNA sequence analysis (ribosoma...

متن کامل

Prevalence and risk factors associated with Leishmania infection in Trang Province, southern Thailand

BACKGROUND Autochthonous cutaneous and visceral leishmaniasis (VL) caused by Leishmania martiniquensis and Leishmania siamensis have been considered emerging infectious diseases in Thailand. The disease burden is significantly underestimated, especially the prevalence of Leishmania infection among HIV-positive patients. METHODS A cross-sectional study was conducted to determine the prevalence...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 18  شماره 

صفحات  -

تاریخ انتشار 2012