Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the trinucleotide (NGG)n PAM repeat is a receptive target for the CRISPR/Cas9 experiments in C. elegans ii. we conclude the allelic spectrum indicates the gRNA-unc-22-1000 induces fairly frequent NHEJ joining events involving deletions and indels but also, a phenotypically distinct class of small in-frame deletions indicative for microhomology-mediated end-joining (MMEJ) as a result of S. pyogenes Cas9 activity at the trinucleotide (NGG)n PAM repeat region. We demonstrate guide RNA-unc-22-1000 could be used to modify complex transgenic C. elegans line expressing human beta-amyloid protein. We provide the evidence for bi-allelic transaction resulting from Cas9 action recovered in experiment in CB1138 him-6 background. We contrast the expected performance of gRNA-unc-22-1000 with guide targeting another type of C. elegans repeat embedding S. pyogenes PAM, the telomeric repeat (TTAGGC)n. We propose that preferential frame restoring MMEJ repair of the Cas9 cut at the 'modules' encoding for poly-glycine in +2(NGG)n position could be useful mode of genome engineering at the naturally occurring (NGG)n PAM embedding repeats dispersed across animal genomes.