Su(var)3–9, Enhancer of Zeste, and Trithorax Domain-Containing 5 Facilitates Tumor Growth and Pulmonary Metastasis through Up-Regulation of AKT1 Signaling in Breast Cancer

Several studies have confirmed the function of Su(var)3–9, Enhancer zeste, and Trithorax (SET) domain-containing 5 (SETD5) in post-translational modifications nonhistone proteins. Mutation SETD5 gene has been implicated progression many human cancers, such as breast cancer (BC), but its functional role BC is still unknown. The current article investigates clinical significance BC. Our show that expression was related to poor outcomes, including lymph node metastasis advanced stage. positively correlated with tumor-associated macrophages. an independent predictor overall survival Furthermore, these down-regulation significantly decreased cell proliferation, metastasis, angiogenesis, increased apoptosis cells. mechanistic analysis showed contributes by interacting AKT1 pathway. Also, vivo experiments blocking inhibited tumor growth pulmonary These findings indicate a potential prognosis marker facilitates In 2018, approximately 2.1 million new (BC) cases were diagnosed females globally, accounting for almost one four women. Current data most countries (154 185). it leading cause cancer-related mortality >100 countries.1Bray F. Ferlay J. Soerjomataram I. Siegel R.L. Torre L.A. Jemal A. Global statistics 2018: GLOBOCAN estimates incidence worldwide 36 cancers 185 countries.CA Cancer J Clin. 2018; 68: 394-424Crossref PubMed Scopus (36994) Google Scholar 2019, American Society's biennial update on female United States indicated over recent 5-year period, rate 0.3% per year.2DeSantis C.E. Ma Gaudet M.M. Newman Miller K.D. Goding Sauer Breast statistics, 2019.CA 2019; 69: 438-451Crossref (883) Despite success hormonal adjuvant chemotherapeutic agents improve prognosis, treating disease challenge because difficult predict individual's response treatment. Currently, efforts are being made reduce cost treatment through development targeted therapies. As such, biomarkers effectively applied diagnosis, predicting therapy, well surveillance following treatment.3Duffy M.J. O'Donovan N. Crown Use molecular markers therapy patients.Cancer Treat Rev. 2011; 37: 151-159Abstract Full Text PDF (72) Therefore, further elucidation underlying mechanisms essential effective therapeutic agents, discovery novel both prognostic predictive value. AKT, serine/threonine kinase, signaling molecule differentiation.4Revathidevi S. Munirajan A.K. Akt cancer: mediator more.Semin Biol. 59: 80-91Crossref (101) It well-characterized effector phosphoinositide 3-kinase (PI3K) PI3K/AKT/mammalian target rapamycin pathway, deregulation plays crucial pathogenesis cancers.4Revathidevi Three AKT genes (AKT1, AKT2, AKT3) identified mammalian genome, principal isoform encoded AKT1, which modulates apoptosis.5Datta S.R. Brunet Greenberg M.E. Cellular survival: play three akts.Genes Dev. 1999; 13: 2905-2927Crossref (3666) phosphorylated at Ser124, Thr308, Thr450, Ser473. Moreover, phosphorylation Thr308 Ser473 generally inducible mostly after cells extracellular stimuli, whereas Ser124 Thr450 appear be basally phosphorylated.6Alessi D.R. Andjelkovic M. Caudwell B. Cron P. Morrice Cohen Hemmings B.A. Mechanism activation protein kinase B insulin IGF-1.EMBO. 1996; 15: 6541-6551Crossref (2440) Genetic epigenetic changes participating pathway activate cancers.7Altomare D.A. Testa J.R. Perturbations cancer.Oncogene. 2005; 24: 7455-7464Crossref (1042) Although direct effect methylation yet reported, upstream regulators shown AKT.8Nakakido Deng Z. Suzuki T. Dohmae Nakamura Y. Hamamoto R. Dysregulation SMYD2-mediated lysine PTEN.Neoplasia. 2015; 17: 367-373Crossref (52) member histone methyltransferase family characterized typically possesses conserved SET domain.9Xiao Wilson Gamblin S.J. domains methylation.Curr Opin Struct 2003; 699-705Crossref (126) enzyme catalyzes monomethylation, dimethylation, or trimethylation ?-amine groups proteins, specifically histones, rearrangement chromatins regulation expression. Epigenetic appears contribute initiation may precede genetic mutations. Dillon et al10Dillon S.C. Zhang X. Trievel R.C. Cheng SET-domain superfamily: methyltransferases.Genome 6: 227-236Crossref (509) assumed participates regulation. mutations associated neurodevelopmental disorders.11Grozeva D. Carss K. Spasic-Boskovic O. Parker Archer H. Firth H.V. Park S.M. Canham Holder S.E. Hackett Field Floyd J.A.B. Hurles Lucy Raymond De novo loss-of-function SETD5, encoding 3p25 microdeletion syndrome critical region, intellectual disability.Am Hum Genet. 2014; 94: 618-624Abstract (69) Scholar, 12Kuechler Zink A.M. Wieland Lüdecke H.J. Cremer Salviati L. Magini Najafi Zweier C. Czeschik J.C. Aretz Endele Tamburrino Pinato Clementi Gundlach Maylahn Mazzanti Wohlleber E. Schwarzmayr Kariminejad Schlessinger Wieczorek Strom T.M. Novarino G. Engels Loss-of-function variants disability core phenotype 3p25.3 syndrome.Eur 23: 753-760Crossref (49) 13Parenti Teresa-Rodrigo Pozojevic Ruiz Gil Bader Braunholz Bramswig N.C. Gervasini Larizza Pfeiffer Ozkinay Ramos Reiz Rittinger Watrin Wendt Wollnik Baquero-Montoya Pié Deardorff M.A. Gillessen-Kaesbach Kaiser F.J. Mutations chromatin functionally link Cornelia de Lange clinically overlapping phenotypes.Hum 2017; 136: 307-320Crossref (34) 14Szcza?uba Brzezinska Kot Rydzanicz Walczak Stawi?ski Werner P?oski mutation likely familial syndromic variable phenotypic expression.Am Med Genet 2016; 170: 2322-2327Crossref (19) Liu al15Liu Kimball Holowatyj Yang Z.Q. alterations methyltransferases their cancer.Oncotarget. 2466-2482Crossref (88) reported mRNA levels up-regulated shorter patients, not fully understood. This predicts We hypothesize signaling. Of importance, our could marker. Tissue microarray used immunohistochemistry (IHC) staining purchased from Shanghai Outdo Biotech Co, Ltd (Shanghai, China). study conducted Declaration Helsinki principles approved Human Ethics Committee Research Yanbian University (Yanji, contained 117 tissues previously fixed formalin then embedded paraffin. median follow-up duration 112 months (range, 2 136 months). MCF-7, MDA-MB-231, umbilical vein endothelial (ATCC, Manassas, VA) grown under conditions specified supplier. All lines Mycoplasma free. reagents vitro experiments: LY294002 (MedChem Express, Shanghai, China) perifosine (Selleckchem, Negative control endoribonuclease-prepared short interfering RNA (esi-SETD5) transfected into Lipofectamine 3000 (Invitrogen, Carlsbad, CA) methods described manufacturer. siRNA–universal negative esi-SETD5 Sigma-Aldrich (St. Louis, MO). Table 1 lists sequence esi-SETD5.Table 1The Sequence Endoribonuclease-Prepared Short Interfering RNAGeneSequenceSETD55?-GATGTACAGAACGCGCTTGAACAACACCTACATTCTAGCAAGGAATTTGTGGGCAAACCTACTATTTTAGACACTATTAATAAGACTGAATTGGCCTGTAATAACACAGTTATTGGTTCCCAAATGCAGTTACAGCTGGGAAGAGTCACTCGTGTTCAAAAGCACCGGAAGATCCTGAGGGCTGCAAGAGATTTGGCTTTGGACACTCTTATAATAGAGTATCGTGGGAAAGTCATGTTACGACAGCAATTTGAGGTCAATGGGCATTTCTTCAAAAAACCATACCCCTTTGTGCTCTTCTACTCAAAATTCAATGGTGTAGAGATGTGTGTGGATGCCCGTACTTTCGGTAATGATGCTCGGTTCATCAGAAGATCATGTACACCAAATGCAGAGGTGCGACACATGATTGCAGATGGG-3? Open table tab IHC staining,16Yang Z.T. Yeo S.Y. Yin Y.X. Lin Z.H. Lee H.M. Xuan Y.H. Cui Kim S.H. Tenascin-C, determinant esophageal squamous carcinoma.PLoS One. 11: 1-14Crossref (41) Western blot,17Yang Ni W.D. Gli1, regulator stem cell, adverse factor carcinoma.J Res Clin Oncol. 143: 243-254Crossref (28) immunofluorescence,18Yang C.Y. Qi W.B. GLI1 promotes stemness intracellular PI3K/Akt/NF?B colorectal adenocarcinoma.Exp Cell Res. 373: 145-154Crossref (24) migration invasion assays18Yang according previous protocols. provides list antibodies used. ?-Actin served control. repeated least times similar results each time.Table 2Antibodies StudyAntibodies againstCompanyCatalog numberSETD5NOVUS (Centennial, CO)NBP2-38257PI3KAbcam (Cambridge, UK)Ab86714p85?Abcamab86714AKT1InvitrogenPA5-29169pAKT-Ser473Millipore (Billerica, MA)05-1003pAKT-Thr308Millipore07-1398SnailAbcamab53519E-cadherinAbcamab40772VimentinMilliporeMABT121Twist1AbcamAb50887?-CateninInvitrogenTA2-62560Bcl-2Santa Cruz Biotechnology (Dallas, TX)sc-7382BaxSanta Biotechnologysc-493Caspase-8AbcamAb25901Cleaved caspase-3CST (Danvers, MA)5 A1ECleaved PRAPAbcamAb32064VEGFMilliporeABS82EPOAbcamAb226956CD105AbcamAb170943Ki-67AbcamAb92742D2-40Proteintech (Wuhan, China)1D9F3Bax, Bcl2 X; Bcl-2, B-cell lymphoma 2; EPO, erythropoietin; pAKT, AKT; PI3K, 3-kinase; PRAP, poly ADP ribose polymerase; VEGF, vascular factor. Bax, intensity proportion positive measured pathologists (Y.X. Z.Y.) no prior knowledge clinicopathologic results, score assigned follows: 1, weak <50% moderate <20% cells; 2, ?50%, 20% 50%, strong 3, ?50% ?20% After having assessed score, positivity case decided cutoff point derived study, taking end points recurrence patients' survival. this 3 regarded brief, plated (200 cells/well) 6-well plates maintained weeks. Next, colonies paraformaldehyde stained crystal violet (1%). Subsequently, imaged determine number (>50 cells/colony). Data graphed means ± SD performed times, triplicate. Cells seeded plate cultured 24 hours form confluent monolayers. A wound generated dragging pipette tip monolayer, washed using prewarmed phosphate-buffered saline remove cellular debris. monitored 0 hours, images captured time digital camera attached inverted phase contrast microscope. 4°C ethanol (70% v/v) hours. that, they 30 minutes propidium iodide solution (10 ?g/mL) comprising ?g/mL RNase Flow cytometry fluorescence-activated sorting examine cycle progression. times. (1 × 106 cells/mL) suspended RPMI 1640 medium, labeled 37°C 20 ?mol/L carboxy-fluorescein succinimidyl ester (Invitrogen). To quench labeling reaction, medium containing fetal bovine serum (10%) added, mixture incubated 10 minutes. ester–labeled twice culture onto plates. harvested same time. proliferation examined C6 flow cytometry. values experiments. Statistical experimental presented Hoechst 33258 Staining Kit (Beyotime Biotechnology, detect nuclei morphology, biologically SD. Thermo Scientific Pierce co-IP kit (Thermo Scientific, Rockford, IL) perform co-immunoprecipitation (co-IP) instructions provided Results representative Briefly, cold Matrigel (Corning Inc., Corning, NY) coat 96-well plate. 4 (2 104 150 ?L conditioned diluted 2:1 without serum, Matrigel-coated wells 6 37°C. microscope observe formation capillary-like structures. Image software version 1.52 (NIH, Bethesda, MD; http://imagej.en.softonic.com, last accessed October, 2019) assess total tube length branching formed image field. Here later, precoated Matrigel. Tube phase-contrast seeding. raw can National Center Information Gene Expression Omnibus site (https://www.ncbi.nlm.nih.gov/geo; accession GSE29431, May, 2019). database analyzed Set Enrichment Analysis (GSEA). GSEA 2.2.4 (http://www.broadinstitute.org/gsea, explore relationship between PI3K/AKT includes key statistics: false rate, nominal P value, normalized enrichment score. animal recommendations Guide Care Laboratory Animals19Committee Update AnimalsNational Council: Animals: Eighth Edition. Academies Press, Washington, DC2011Crossref NIH Animal Committee. 100 suspension MDA-MB-231 107) 50% inoculated (subcutaneously) right left flank 5-week–old BALB/c nude mice (Vital Rivers, Beijing, generate model. Tumors weeks inoculation. lung 106) injected tail mice. sacrificed injection. nodules counted harvesting lungs. For histologic examination, hematoxylin eosin conducted. SPSS 25.0 (SPSS, Chicago, GraphPad Prism 5.01 (GraphPad San Diego, CA). Correlation Spearman correlation analysis. Overall (OS) calculated Kaplan-Meier method followed log-rank test (for comparing curves). Survival period date surgery patient died follow-up. Cox proportional hazards model multivariate Clinicopathologic factors, statistically significant univariate analysis, included covariables Hazard ratio 95% CIs Two-group comparisons t-test (two tailed). < 0.05 considered significant. codes OS patients.15Liu methyltransferase, controls acetylation, mediates transcription, functions embryo mammals.20Osipovich A.B. Gangula Vianna P.G. Magnuson Setd5 co-transcriptional acetylation.Development. 4595-4607Crossref (36) context BC, tissue primary specimens subsequently (Figure A–D). 89 (76%) (Table 3). had low ductal carcinoma situ (pT0) 1A), invasive (pT1 pT3) C). high D2-40–positive vessels observed lymphatic samples 1D). Among 51 patients 48 (94%) staining, higher compared those (62.1%) (P 0.001) prevalence gradually early stage disease, 60.9% exhibited more II, III, IV 77.1%, 93.1%, 100%, respectively association pathologic diagnosis Clinical Proteomic Tumor Consortium also analyzed. obtained online tool UALCAN relative normal 1E). = 0.009) 1F). Univariate regression 0.001), 0.002), distant 0.012), 0.010) factors 4). Multivariate revealed 0.036) imply biomarker BC.Table 3Comparison Characteristics According TissuesVariablenSETD5 (-), n (%)SETD5 (+), (%)?2RP valueAge, years5.9220.2370.015 ?508225 (30.5)57 (69.5) >50353 (8.6)32 (91.4)Grade0.6490.0120.723 Well319 (29.0)22 (71.0) Moderately439 (20.9)34 (79.1) Poorly4310 (23.3)33 (76.7)pT stage5.6230.2260.131 T1103 (30.0)7 (70.0) T25015 (30.0)35 T34810 (20.8)38 (79.2) T490 (0.0)9 (100.0)Lymph metastasis15.7860.388<0.001 Negative6625 (37.9)41 (62.1) Positive513 (5.9)48 (94.1)Clinical stage12.7550.3070.013 I4618 (39.1)28 (60.9) II358 (22.9)27 (77.1) III292 (6.9)27 (93.1) IV70 (0.0)7 (100.0)ER1.8850.1270.170 Negative6218 (29.0)44 Positive5510 (18.2)45 (81.8)PR1.2700.1040.260 Negative5616 (28.6)40 (71.4) Positive6112 (19.7)49 (80.3)HER21.6310.1180.202 Negative417 (17.1)34 (82.9) Positive7621 (27.6)55 (72.4)P530.4230.0600.516 Negative8118 (22.2)63 (77.8) Positive3610 (27.8)26 (72.2)ER, estrogen receptor; HER2, epidermal receptor PR, progesterone pT, tumor. 4Univariate Prognostic Variables Patients Using Proportional-Hazards RegressionCharacteristicUnivariate analysesMultivariate analysesHR95% CIP valueHR95% years0.0970.088 <501.001.00 ?501.4930.931–2.3971.6270.931–2.842pT stage0.0010.009 T11.001.00 T23.1730.885–11.3782.1370.425–10.754 T36.5112.052–20.6655.8591.361–25.221 T48.3072.315–29.8177.1411.422–35.858Lymph metastasis0.0020.164 Negative1.001.00 Positive2.1301.326–3.4221.5120.845–2.706Distant metastasis0.0120.110 Positive1.7381.128–2.6791.4980.912–2.460SETD50.0100.036 Positive1.8301.153–2.9041.6871.034–2.754HR, hazard ratio; ER, HR, Properties macrophages (TAMs) help tumor, main peculiarities suppression immune matrix remodeling, angiogenesis stimulation remain important development.21Kovaleva O.V. Samoilova D.V. Shitova M.S. Gratchev kidney cancer.Anal Pathol 2016: 9307549-9307554Google adjacent macrophage population implying TAM infiltration along areas around 2A). makers, CD68 CD204 CD206 T-cell immunoglobulin mucin CD163 0.0048) Profiling Interactive Genome Atlas B–F). Thus, TAMs However, required specific receptor, aggressive triple-negative nonaggressive ?–positive MCF-7 how affects progression, impact examined. First, transfecting them SETD5-targeted 3A). increases morphologic hallmarks apoptotic death knockdown 3B). observations blot assay. indicates inhibition enhances cells, caspase-8, cleaved polymerase, caspase-3, X/B-cell 3C). addition, assays 3D) colony 3E) clonogenicity 0.001). analyses primarily subpopulations S 3F). Collectively, contributed budding phrase describe thin anaplastic cord, undifferentiated individual free front tumors recognized composed neoplastic epithelium aggregates (up five cells).22Prall Tumour carcinoma.Histopathology. 2007; 50: 151-162Crossref (291) diffuse (Supplemental Figure S1). closely epithelial-mesenchymal transition (EMT), exhibit migratory characteristics.23Mitrovic Schaeffer D.F. Riddell R.H. Kirsch carcinoma: take notice.Mod Pathol. 2012; 25: 1315-1325Crossref (186) Scholar,24Zlobec Lugli Epithelial mesenchymal