منابع مشابه
Nucleotide sequence of a cDNA encoding mouse beta casein.
Beta casein 1s a major «1 Ik protein produced by the lactating mammary gland and I t s gene expression 1s hormonally controlled ( 1 ) . cDKAs encoding mouse beta casein wore Isolated from a muse maoaary gland l ibrary prepared as described ( 2 ) , using a short cONA clona of mouse beta casein (1) as a hybridization probe. The longest cDNA clone was chossn and the DNA sequence of each strand was...
متن کاملAutoantibodies to αS1-Casein Are Induced by Breast-Feeding
BACKGROUND The generation of antibodies is impaired in newborns due to an immature immune system and reduced exposure to pathogens due to maternally derived antibodies and placental functions. During nursing, the immune system of newborns is challenged with multiple milk-derived proteins. Amongst them, caseins are the main constituent. In particular, human αS1-casein (CSN1S1) was recently shown...
متن کاملcDNA sequence of rabbit tissue factor pathway inhibitor.
The authors note the following errors in the reported cDNA sequence of rabbit tissue factor pathway inhibitor, TFPI These changes increase sequence identity with human TFPI at both the cDNA and amino acid level, but do not otherwise alter the conclusions presented in the original report.
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملContributions of Terminal Peptides to the Associative Behavior of αs1-Casein
The Nand C-terminal segments of bovine αs1-caseinB (f1-23 and f136-196) were characterized under conditions that promoted or inhibited self-association to determine the relative contributions of each fragment to the interaction of αs1-casein with itself or with other caseins. In earlier studies of f1-23, nuclear magnetic resonance (NMR) data and circular dichroism (CD) spectra showed that its c...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Nucleic Acids Research
سال: 1988
ISSN: 0305-1048,1362-4962
DOI: 10.1093/nar/16.24.11813