Enteric Coronavirus in Ferrets, the Netherlands

نویسندگان

چکیده

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Enteric Coronavirus in Ferrets, the Netherlands

To the Editor: Coronaviruses (CoVs) are enveloped, positive-sense, single-stranded RNA viruses that can cause acute and chronic respiratory, enteric, and central nervous system disease in a variety of animal species (1). Recently, a novel ferret enteric CoV (FRECV) was indentifi ed in domesticated ferrets (Mustela putorius) in which epizootic catarrhal enteritis had been diagnosed; the illness ...

متن کامل

Determination of Ferret Enteric Coronavirus Genome in Laboratory Ferrets

Ferret enteric coronavirus (FRECV) RNA was detected in laboratory ferrets. Analysis of the complete genome sequence of 2 strains, FRCoV4370 and FRCoV063, revealed that FRECV shared 49.9%-68.9% nucleotide sequence identity with known coronaviruses. These results suggest that FRECV might be classified as a new species in the genus Alphacoronavirus.

متن کامل

Cross-protection against a human enteric coronavirus and a virulent bovine enteric coronavirus in gnotobiotic calves.

A group 2 human coronavirus designated HECV-4408 was isolated from a child with acute diarrhea and is antigenically and genetically more closely related to bovine coronavirus (BCoV) than to human coronavirus OC43 (X. M. Zhang, W. Herbst, K. G. Kousoulas, and J. Storz, J. Med. Virol. 44:152-161, 1994). To determine whether HECV-4408 infects gnotobiotic calves and induces cross-protective immunit...

متن کامل

Novel Hepatitis E Virus in Ferrets, the Netherlands

Table 1. Primers used for amplification and sequencing of the ferret HEV genome* Primer Sequence, 5 3 Nucleotide position† FRHEV-F1 GGCTGGCGTTTGCTTGGAGG 256–275 FRHEV-R1 TTCGAATCCAACGCTGGTGAC 1158–1178 FRHEV-F2 GTACTATCACGGCCAATGAG 1077–1096 FRHEV-R2 CAGCCTATAGGGCATAGTAAG 1681–1701 FRHEV-F3 GCCCTGACCTTGGAGCTGAC 1592–1611 FRHEV-R3 CTATTGGCGGCGTTAACTAG 2078–2097 FRHEV-F4 GAGCTTTTGCCGGATGGGTC 2015...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Emerging Infectious Diseases

سال: 2011

ISSN: 1080-6040,1080-6059

DOI: 10.3201/eid1708.110115