077 Epidermal equivalents of filaggrin null keratinocytes do not show impaired skin barrier function

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Hypoxia inducible factors regulate filaggrin expression and epidermal barrier function

A functional epidermal skin barrier requires the formation of a cornified envelope from terminally differentiating keratinocytes. During this process, multiple genetic and environmental signals coordinately regulate protein expression and tissue differentiation. Here we describe a critical role for hypoxia-inducible factors (HIFs) in the regulation of filaggrin expression and skin barrier forma...

متن کامل

Self organization of Fibroblasts and Keratinocytes in morphogenesis of dermal-epidermal junction in human skin equivalents

Introduction Dermal epidermal junction (DEJ) is a complex macromolecular structure which establishes the boundary between two major skin compartments, epidermis and dermis and the cellular components of these layers play a major role in its organization (1). We are interested in the structural and functional analysis of the epidermis formed in human skin equivalent (HSE) models that uses co-cul...

متن کامل

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR...

متن کامل

Dysregulated function of normal human epidermal keratinocytes in the absence of filaggrin

The aim of the present study was to investigate the impact of filaggrin knockdown on the function of normal human epidermal keratinocytes (NHEKs). Filaggrin expression levels in NHEKs were knocked down by lentivirus (LV) encoding small hairpin RNA (shRNA), with control cells infected with nonsense shRNA or not infected. Cell migration and invasion were assayed using Transwell inserts, cell adhe...

متن کامل

Skin barrier in atopic dermatitis: beyond filaggrin*

Atopic dermatitis is a chronic inflammatory skin disease with a complex pathogenesis, where changes in skin barrier and imbalance of the immune system are relevant factors. The skin forms a mechanic and immune barrier, regulating water loss from the internal to the external environment, and protecting the individual from external aggressions, such as microorganisms, ultraviolet radiation and ph...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Journal of Investigative Dermatology

سال: 2016

ISSN: 0022-202X

DOI: 10.1016/j.jid.2016.06.095