introduction acetic acid bacteria are large group of obligate aerobic gram negative bacteria with the ability to oxidize ethanol to acetic acid (1). they are widely distributed in natural habitats and classified in family acetobacteraceae. members of this family are useful in industrial production of vinegar(2). acetic acid bacteria (aab) can use substrates as glucose, ethanol, lactate or glycerol as energy sources. however, most of these compounds are not completely oxidised into co2, and water and several metabolites, especially acetic acid, are accumulated in the growth medium. aab are commonly found in nature, because of their high resistance to acidity and the variety of substrates that they can use (3). these bacteria have been isolated from alcoholic beverages, vinegar, fruits, flowers, honey, bees, sugar cane juices, soil, and water (4). isolation of aab with high production and better acidotolerance potentials has been the subject matter of researches. the thermotolerant strains were able to oxidise ethanol at high temperatures (38–40°c) and ethanol concentrations (up to 9%) without any appreciable lag time; they worked rapidly with a higher fermentation rate, where mesophilic strains were unable to do it. recently, (5) have selected two strains of a. tropicalis and a. pasteurianus species for the ability to grow at 40 and 45 °c and proposed them to produce an artisanal spirit vinegar. this study aims at the isolation and identification acetic acid bacteria from fruits, characterization and optimization of indigenous acetic acid bacteria and evaluation of their productivity and to compare the growth characteristics. since isfahan is located in a tropical area, it is likely that species of acetic acid bacteria with good acid production potentials will be found in part of iran. identification of the isolated acetic acid bacterium was carried out by 16s rrna analysis. materials and methods: materials chemical ingredients, culture media ands all other chemical reagents were from sigma (usa) or merck. restriction endonucleases were obtained from cinagene (iran). gel purification kit and was from bioneer (korea). primers were synthesized by bioneer. primary screening these isolates were from apple, fig, grape, apricot, date, nectarine, sloe, peach, pear and flame. ripened samples were collected in august-september 2008. they were then left for a few days for over-ripening which were then crushed aseptically and were bottle incubated at 30oc/7days. 100 ?l from different dilutions of the bottles were then spread on plates of glucose solid gyc medium (10% glucose, 1.0% yeast extract, 2.0% calcium carbonate, 1.5% agar, ph 6.8) supplemented with 100 mg l-1 of pimaricin (sigma-aldrich; steinheim; germany) to inhibit the growth of yeasts and moulds. this antibiotic was added to the culture medium from the stock solution after the medium had been sterilized. plates were incubated at 30°c for 3–4 days under aerobic conditions. colonies showing a clear halo on gyc were selected to isolate dominant species with high probability(6). acetobacter and gluconobacter are distinguished from acetobacteriacea family on the basis of acid production from calcium caorbonate. morphological and cultural characteristics of the isolates were examined by incubating at 30°c for 2 days on gyc medium. acetobacter and gluconobacter were distinguished from each other on carr medium in the presence of bromocresol green. acetobacter turns the medium color to yellow and then to green while gluconobacter turns it to yellow only. acetic acid production the selected colonies from gyc were transferred to bhi broth until od600 of 0.5 is achieved. inoculum size of 4% from the preceding bhi broth was cultured in yeast glucose ethanol acetic acid (ygea) medium for acetic acid production. the production medium was aerated and samples were taken at the intervals of 48 hours. estimation of acetic acid 5ml of the culture was mixed with 20ml of distilled water. 3-5 drops of phenolphthalein indicator was added. the solution was titrated against 0.5n naoh. the amount (g) of acetic acid produced in 100 ml of medium was calculated using the following formula: acetic acid (g/100ml)= volume of naoh (ml) used in titration × 0.03 × 20 identification of the bacterial isolates biochemical tests for identification of acetobacter spp. the following tests were performed to identify the acetobacter spp. isolated. catalase, production of acid from d-glucose, nitrate reduction, production from d-glucose of 5-keto-d-gloconate and ketogenesis from glycerol (7, 8). nitrate reduction was tested from nitrate peptone water (per liter of distilled water, ph 7.0: peptone, 10 g; kno3, 2 g)(9). the biochemical identification tests were followed by molecular methods to validate the data obtained thereby. identification of the isolates by 16s rrna dna extraction the bacterial cells were grown in gyc medium for 2–5 days at 30oc. the chromosomal dna was isolated as follows: the cells grown in lb medium, were harvested by centrifugation at 4000-5000 rpm for 5 min. the pellets were suspended in te buffer, proteinase k and 10% sodium dodecyl sulphate (sds) solution and the incubation was done at 37oc for 60 min. nacl (5 n) and cetyltrimethylammonium bromide (ctab)/nacl solution was then added and incubated at 60 oc for 10 min. to eliminate cell polysaccharides. equal volume of phenol solution was then added and centrifuged at 4000-5000 rpm for 5 min. supernatant was collected and equal volume of phenol/chloroform was added and centrifuged at 4000-5000 rpm for 5 min. supernatant was collected and equal volume of chloroform/isoamylic alcohol (1:24) was added and centrifuged at 4000-5000 rpm for 5 min. the supernatant was collected and equal volume of chloroform was added and centrifuged at 4000-5000 rpm for 5 min. the supernatant was collected and 1 ml of cole (-20oc) isopropanol was added and refrigerated at -70oc for 2 hours. the solution was then centrifuged at 6000 rpm/5 min. the supernatant was decanted and ethanol (70%) was added to the precipitate. the tube containing precipitate was centrifuged at 6000 rpm/5 min. and was dried under a table lamp. dna was suspended in 20 ?l of te buffer or deionized distilled water for further use. the size of the dna was checked by 0.5% agarose gel electrophoresis in 0.5 x tbe buffer (89mm tris-borate, 89mm boric acid, 2mm edta; ph 8.0) with a 1-kb dna ladder as size marker. the gel was visualized by ethidium– bromide staining under uv light. oligonucleotide primers primers for the pcr amplifcation of 16s rrna were selected from conserved regions of the 5- end (16sd, 5-? agagtttgatcctggctcag -3) and the 3-end (16sr, 5- acggctaccttgttacgacct - 3 ) of the 16s rrna. pcr amplification and analysis of the products pcr conditions consisted of 1 µl-1 (50 ng µl-1) dna, 1µl-1 of each primer (20 pm), 250 µm of each dntp, 40 mm mgcl, and 1µl of 2.5u taq dna polymerase in a final volume of 25 µl on a thermal cycler . the pcr procedure was as follows: initial denaturation at 95°c for 1min and 35 cycles of 1 min at 94°c, 1 min at 58°c, 2 min at 72, followed by additional 10 min at 72°c. the amplified dna products were run on electrophoresis in a 1% (w/v) agrose gel. the pcr products (1500 bp for 16s rrna) were purified using a pcr purification kit as per the manufacturers instructions. sequencing of partial 16s rdna regions aab isolated strain was identified by sequencing partial 16s rdna regions. the following primers were used for sequencing: upper primer: 5َ ? agagtttgatcctggctcag 3َ lower primer: 5َ acggctaccttgttacgacct 3َ restriction analysis pcr product was digested with ecor1 and xba1. restriction fragments generated by ecor1 and xba1were detected by 2% agarose electrophoresis gel. lengths of both amplification products and restriction fragments were detected by comparison with dna ladder. eight microliters (approximately 50–100 ng dna) of each pcr amplified 16s rrna gene from bacterial isolate was digested for 3 h at 37 °c with ecor1 and xba1 restriction endonucleases, as recommended by the manufacturer (invitrogen, carlsbad, ca, usa). restriction fragments were analyzed by 2% w/v agarose gel electrophoresis. the isolated bacterial sequence was subjected to software analysis (www.ebi.ac.uk and http://itol.embl.de/) to draw phylogenic tree. optimization of bacterial growth and production conditions three factors of culture medium composition, temperature and shaking conditions were considered for culture conditions. 200 µl of stock culture (0d600= 2.3) was inucoluted into 15 ml of each of bhi and lb broth. the broth cultures were then incubated at 25, 31, 37°c at the shaking rates of 210 rpm and 180 rpm. the optical density and cell dry weight were measured after 3,6,9 and 12 hours. in brief, 5ml of culture medium was centrifuged and the pellet was dried at 60°c for 1 hour and then at 50°c over night. three factors of aeration (3l/min and 2.5l/min), inucolum size (3 and 4% from bhi broth at od600=0.5), glucose content, yeast extract, ethanol, acid acetic were considered for production conditions. the basal medium (ygea) was composed of ethanol, yeast extract, glucose and acetic acid each at 2% level. 200 µl of stock (0d= 2.3) was inucoluted in 15 ml of bhi broth. an inoculum size of 4% from bhi broth at od600=0.5 was inucoluted in production medium under 3l/min aeration. preservation conditions the isolate was preserved in lb, bhi, nutrient, gyc and carr media to evaluate the viability, longevity and acid productivity after lapse of at least one month. results all strains tested produced acid from d-glucose, ethanol. the strains showed clear zones on basal agar plates containing caco3. therefore, they were regarded as acetobacter and gluconobacter and used for further study. a total of 37 isolates were selected as acetic acid bacteria. they were all gram-negative, circular or rod-shaped aerobes with non-pigmented colonies. the isolates were tested for acetic acid production in the basal medium. oxidation of acetate to carbon dioxide and water was found positive in 4 samples which were then regarded as acetobacter. the isolates producing higher amount of acetic acid were selected (figure 1) for further processing until one which produced the highest amount of acetic acid is selected. the bacterial isolate from peach showed the highest productivity of 10.03% (figure 1). the isolate were negative for oxidase, gelatinase, h2s, indole. the preliminary indentification on the basis of biochemical tests (table 1) brought about possibility of having one of the three acetobacteria namely: a.orleanensis, a.pasteurianus and a.pomorum. hence molecular techniques were employed for more precise identification. the 16s rrna gene was successfully amplified by pcr (figure 2). the sequencing analysis of the pcr product by macrogen company (south korea) revealed a divergent strain of a. pasteurianus (gene bank accession number # gu059865). the isolated strain exhibited more than 80% sequence similarity based on 16s rrna sequence analysis (figure 3). soft ware analysis suggested two restriction sites on the gene. the pcr product was accordingly subjected to ecori and xbai digestions to obtain 925+625 and 1220+330 fragments respectively (figure 4). the phylogenic tree (figure 5) shows the highest similarity and closer relationship of the isolate to a.pasteurianus. the optimum conditions for bacterial growth were 31oc at a shaking speed of 210 rpm (table 2). the optimum conditions for acid production was a medium composed of 2% glucose, 2% yeast extract, 3% ethanol and 3% acid acetic (table 3). the isolate grew well in bhi broth too. inoculum size of 4% from growth medium at 3l/min aeration level in the production medium was found more efficient production conditions. preservation conditions gyc was found as the best medium to preserve the isolated a. pasteurianus. discussion isolation and identification of bacterial species overoxidation is a serious problem during vinegar making without temperature control in tropical and temperate countries. reasons for overoxidation could be changes in the population or in the physiology of strains, stimulated by the lack of alcoholic substrate (7). hence there is always a need for new microbial isolates to meet the biotechnologists requirements. the probability to isolate different species from the samples increases irrespectively to their relative presence (10). the number of strains able to grow decreases with the increase of the glucose due to a strong effect on bacterial growth of glucose concentration. in the present study, the isolated bacteria were able to grow at 10% sugar concentration of gyc. production of 10.03% acetic acid at the initial stage of isolation (figure 1) was promising. we therefore attempted to characterize the isolates biochemically (table 1). in addition to their ability to oxidise ethanol, acetobacter and gluconacetobacter species can further oxidise acetic acid to co2 and h2o, generating the so-called acetate overoxidation, that is carried out by the tricarboxylic acid cycle when there is a high level of dissolved oxygen and no ethanol in the medium. strains of gluconobacter are not able to overoxidise because of nonfunctional ?-ketoglutarate dehydrogenase and succinate dehydrogenase of tricarboxylic acid cycle; they can only oxidize ethanol to acetic acid(11). acetic acid bacteria are characterized by the ability to oxidize alcohols or sugars incompletely, and a common feature to most of them is the ability to oxidize ethanol to acetic acid. acid production from ethanol, generally shown with the method described by (12) as a clearing of the opacity in the medium around the bacterial growth or with the method described by (13) as a colour change of the indicator bromocresol green in the medium from green to yellow (14) confirm our findings in the present study that the isolate is acetobacter. this is further validated by oxidation of acetate to co2 and h2o (14) and ketogenesis from glycerol(13) (table 1). the isolate grew well in the presence of 3% acetic acid. this finding is in support of acetobacter growth in the presence of 0.35% acetic acid (ph 3.5) (15). the majority of isolated strains was able to grow at 7% v/v of ethanol, and some of them at 11 % of ethanol. these findings are comparable to those of (16)who reported isolation of bacterial strains with ability to grow at 5% v/v of ethanol. the identification methods based on phenotypic characteristics of aab are not reliable and very time-consuming. therefore, they have been complemented or replaced by different molecular techniques, in particular dna:dna hybridizations (8, 15, 17, 18) and pcr-based genomic fingerprinting techniques such as restriction fragment length polymorphism (rflp) analysis of pcr-amplified 16s rrna(19-22) or 16s– 23s rrna intergenic spacer regions(20, 22-25), randomly amplified polymorphic dna (rapd) fingerprinting (26, 27). however, these molecular methods are not appropriate for routine analysis of large amounts of samples that can be isolated from nature. some quick and reliable techniques such as rflp analysis of pcr-amplified 16s rrna gene has been considered as an appropriate technique for the differentiation and characterization of microorganisms(28). the accurate identification of this isolate required genotypic characterization because phenotypic characteristics are very similar(17). pcr–rflp of the 16s rrna gene has already been used to identify aab isolates and to characterize reference strains(21, 22). amplified products of the 16s rrna gene contained approximately 1500 bp (figure 2). this fragment was sequenced (1339bp) and aligned with various acetobacter species. the highest similarity was found with a. pasteurianus (figure 3). pcr–rflp of the 16s rdna allow the identification of the aab in a shorter period of time, compared with the time-consuming techniques. the use of these techniques for aab differentiation is proposed for routine laboratory analysis because of its easiness, the general use of a single pcr and limited restriction analysis, and for the low cost as compared to the techniques used to identify the novel aab species. two restriction endonucleases (ecori and xbai) were identified on the isolated gene using clc sequence viewer 4. several authors reported molecular procedures based on the restriction fragment analysis of 16s(21-23). figure 4 shows the patterns obtained with each of the restriction endonucleases of the 16s rrna gene needed to identify the isolated bacterium. this analysis confirmed identity of the isolate as a. pasteurianus. optimal growth and acetic acid production conditions temperature optimisation is essential for any biotechnological process as above optimum temperature, bacterial deactivation processes occur. this deactivation is attributed to the essential enzymes denaturation, membrane damage that causes cellular constituents scattering and the organisms become more sensitive to the toxic effect of acetic acid(29). minimum and maximum growth temperatures are more difficult to define both for the variability among the species and for the influence of medium composition. about upper temperature limits, several studies showed the occurrence of thermotolerant aab strains in industrial vinegar production(30). in the present study the optimum growth temperature was found to be 31°c (table 2,3). optimum ph the optimal ph growth of aab is between 5.0–6.5 (31). in the present study the optimum ph for growth and acid production had a wider range of 3-5. aab are also able to grow at lower ph values, where bacterial activity has been detected for ph values lower than 3(32). however the tolerance to low ph is strongly dependent on other parameters, such as ethanol concentration and oxygen availability. conclusions the results are suggestive of isolation of an indigenous acetic acid bacteria. pilot plan is suggested to study applicability of the isolated strain in acetic acid production.