PX-478 is a new agent known to inhibit the hypoxia-responsive transcription factor, HIF-1alpha, in experimental tumors. The current study was undertaken in preparation for clinical trials to determine which noninvasive imaging endpoint(s) is sensitive to this drug's actions. Dynamic contrast-enhanced (DCE) and diffusion-weighted (DW) magnetic resonance imaging (MRI) were used to monitor acute e...

This is the supplementary material for the ICML 2013 paper Dependent Normalized Random Measures by the same authors. A. Notation & Preliminary We list some of the notation used in this paper in Table 1 for reminder. A.1. Definitions For completeness, we restate the definition of MNRM and TNRM. We are given a Poisson process on a product space R×Θ×R with intensity measure ν(dw,dθ,da) (we will us...

National geological survey works have characteristics of data enormousness, computing denseness, resource distribution, and applications heterogeneousness. As innovative information infrastructure and service architecture, grid can meet geological survey application requirements by implementing sharing and cooperation of distributed and heterogeneous resources. Based on grid technologies and OG...

Currently, there are many contaminants of concern that need to be accurately determined help assess their potential environmental hazard. Despite increasing interest, yet few occurrence data exist, likely because they present at low levels and in very complex matrices. Therefore, multiresidue analytical methods for determination highly sensitive, selective, robust. Particularly, due the trace t...

The dipeptide N-acetylglutaminylglutamine amide (NAGGN) was discovered in the bacterium Sinorhizobium meliloti grown at high osmolarity, and subsequently shown to be synthesized and accumulated by a few osmotically challenged bacteria. However, its biosynthetic pathway remained unknown. Recently, two genes, which putatively encode a glutamine amidotransferase and an acetyltransferase and are up...

The accumulation of polychlorinated biphenyls (PCBs), DDTs, chlordanes, BHCs, dieldrin, heptachlor epoxide and other organochlorinated pesticides (OCPs) was measured in the tissues of different edible fishes collected along the Virginia Coast by employing the methods: MSPD (Matrix Solid Phase Dispersion) and GC-ECD (Gas Chromatography with Electron Capture Detector). BHC4s were the most predomi...

The influences on gene expression by codons at positions +2, +3, +5 and +7 downstream of the initiation codon have been compared. Most of the +2 codons that are known to give low gene expression are associated with a higher expression if placed at the later positions. The NGG codons AGG, CGG, UGG and GGG, but not GGN or GNG (where N is non-G), are unique since they are associated with a very lo...

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...

To investigate how consensus is reached on a large self-organized peer-to-peer network, we extended the naming game model commonly used in language and communication to Naming Game in Groups (NGG). Differing from other existing naming game models, in NGG everyone in the population (network) can be both speaker and hearer simultaneously, which resembles in a closer manner to real-life scenarios....

Today, agrigenomics researchers have a wide variety of technologies at their disposal for collecting genetic information. Array-based approaches to SNP screening have been the method of choice in analyzing and associating traits with regions of the genome for many plants and animals. As sequencing costs continue to decline, new approaches that leverage next-generation sequencing (NGS) technolog...