in present pet/ct scanners, pet attenuation correction is performed by relying on the information given by ct scan. in the ct-based attenuation correction methods, dual-energy technique (dect) is the most accurate approach, which has been limited due to the increasing patient dose. in this feasibility study, we have introduced a new method that can implement dual-energy technique with only a si...

INTRODUCTION The most commonly used test for monitoring heparin therapy is the activated partial thromboplastin time (aPTT). The response of available aPTT reagents to heparin varies significantly. The aim of this study was to highlight the differences between aPTT reagents stored in a dried format to select the most suitable formulations to be used for the development of point-of-care diagnost...

We evaluated 4 volume-based automatic image registration algorithms from 2 commercially available treatment planning systems (Philips Syntegra and BrainScan). The algorithms based on cross correlation (CC), local correlation (LC), normalized mutual information (NMI), and BrainScan mutual information (BSMI) were evaluated with: (1) the synthetic computed tomography (CT) images, (2) the CT and ma...

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs...

Minimally invasive laparoscopic surgery is widely used for the treatment of cancer and other diseases. During the procedure, gas insufflation is used to create space for laparoscopic tools and operation. Insufflation causes the organs and abdominal wall to deform significantly. Due to this large deformation, the benefit of surgical plans, which are typically based on pre-operative images, is li...