Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...

Partial migration (when only some individuals in a population undertake seasonal migrations) is common in many species and geographical contexts. Despite the development of modern statistical methods for analyzing partial migration, there have been no studies on what influences partial migration in tropical environments. We present research on factors affecting partial migration in African buff...

The presence of bovine tuberculosis (Mycobacterium bovis) in the Kruger National Park (KNP) was determined for the first time in 1990. It was diagnosed in an African buffalo (Syncerus caffer) bull, which was found recumbent and in an emaciated and moribund state near the south-western boundary fence. This prompted an investigation into the bovine tuberculosis (BTB) status of the KNP, with empha...

The collection, processing and certification of a new sediment Standard Reference Material (SRM), SRM 2704, is described. Collected from the bottom of the Buffalo River in New York State during the fall of 1986, SRM 2704 is certified for 25 elements with information provided on another 22 elements. Improvements in analytical methods as well as the application of well-defined quality-control pro...

AIM In Egypt as in many other countries, river water buffalo (Bubalus bubalis) is considered an important source of high-quality milk and meat supply. The objective of this study was to investigate serotypes, virulence genes, and antibiotic resistance determinants profiles of Escherichia coli isolated from buffalo at some places in Egypt; noticibly, this issue was not discussed in the country y...

This study was conducted to evaluate histochemical alterations of river buffalo’s uterine wall acid andalkaline phosphatases (ALP and ACP), lipase and carbohydrate ratio during follicular and luteal phases.Forty apparently healthy and non pregnant river buffalos were considered for removal of the uterus aftersacrifice in slaughterhouse. All dissected uteri were divided into two luteal (by obser...