نتایج جستجو برای: kappa frame
تعداد نتایج: 133678 فیلتر نتایج به سال:
To determine whether a foreign unrearranged immunoglobulin gene can be functionally rearranged and expressed in vivo, a rabbit b9 kappa light chain gene construct containing a single germ-line kappa chain variable (V) region gene (V kappa), the five kappa chain joining (J) segments (J kappa), and the kappa chain constant (C) region germ-line gene (C kappa) was introduced into fertilized mouse e...
The V kappa10 family of murine light chain Ig genes is composed of three members, two of which (V kappa 10A and V kappa 10B) are well used. V kappa 10C, the third member of this family, is not detected in any expressed Abs. Our previous work showed that V kappa 10C is structurally functional and can recombine, but mRNA levels in spleen were extremely low relative to those of V kappa 10A and V k...
The human pre-B acute lymphoblastic leukemia cell line, BLIN-1, has been previously shown to undergo kappa light chain rearrangement in vitro, making it a valuable resource for analyzing pre-B to B cell differentiation. We have examined the recombination potential of BLIN-1 by characterizing several independently derived kappa-expressing subclones for DNA rearrangement and V kappa gene usage. A...
Critical to our understanding of the immune system diversity is the determination of the number of germ line V genes. The total number of V genes is given by the product: number of subgroups x number of germ line genes per subgroup. Studies of kappa chains and of embryonic DNA indicate 5-10 V genes per subgroup. Statistical analysis of the limited sequence data of mouse kappa chains suggest abo...
We have analyzed the structure of Ig kappa chain genes in B cell lines derived from a human individual who cannot synthesize any kappa chains, and whose Igs all contain lambda chains (1). We have characterized secondary DNA recombination events at two kappa alleles which have undergone misaligned V-J recombinations. One such secondary recombination has joined the flanking sequences of a V kappa...
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید