نتایج جستجو برای: تکرار سه نوکلیوتیدی ggn

تعداد نتایج: 160109  

Journal: :Sustainability 2023

The state of seafood resources around the world has been declining for last 50 years. There are multiple global, regional, and national regulatory arrangements that make an effort to revert this situation. Marine Stewardship Council (MSC) is a voluntary global instrument, believed foster sustainability in commercial fishing practices. This paper analyzes institutionalization MSC Finland Russia,...

Journal: :Nucleic acids research 1980
M W Kilpatrick R T Walker

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle i...

مرامی, آناهیتا, میر, مازیار, نوری, مهتاب,

سابقه و هدف: امروزه ثبت رادیوگرافی جانبی سر در وضعیت طبیعی سر (NHP) توصیه شده و قابلیت تکرار بالایی برای آن عنوان شده است، ولی مطالعات طولانی مدت کمی بر روی تکرار پذیری این وضعیت صورت گرفته است. لذا این مطالعه با هدف تعیین فتوگرافیک قابلیت تکرار وضعیت طبیعی سر پس از گذشت سه سال طراحی شد.مواد و روشها: این مطالعه یک مطالعه توصیفی از نوع Longitudinal بر روی 27 نفر از دانشجویان داوطلب دانشکده دندان...

Journal: :European Journal of Cancer 2021

AbstractAim of the study Benefit from temozolomide (TMZ) chemotherapy in treatment isocitrate dehydrogenase (IDH)–wild-type glioblastoma is essentially limited to patients with O6-methylguanine DNA methyltransferase (MGMT) promoter–methylated tumours. Recent studies suggested that telomerase reverse transcriptase (TERT) promoter hotspot mutations may h...

2016
Yuki Owada Atsushi Yonechi Mitsunori Higuchi Hiroyuki Suzuki

BACKGROUND Grand-glass nodule for CT image has thought to be less aggressive tumor in lung cancer. Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK)-positive lung cancer presenting with Ground-glass nodules (GGNs) is relatively rare, and few such cases have been reported. CASE PRESENTATION An asymptomatic 56-year-old woman exhibited a 1.1-cm GGN in the low...

2012
Ashis Kumar Dhara Sudipta Mukhopadhyay Niranjan Khandelwal

In this paper we have investigated a new approach for texture features extraction using co-occurrence matrix from volumetric lung CT image. Traditionally texture analysis is performed in 2D and is suitable for images collected from 2D imaging modality. The use of 3D imaging modalities provide the scope of texture analysis from 3D object and 3D texture feature are more realistic to represent 3D ...

ژورنال: :journal of dental school, shahid beheshti university of medical sciences 0
مهتاب نوری mahtab nouri dental school, shahid beheshti university of medical sciences, tehran–iran.دانشکده دندانپزشکی، دانشگاه علوم پزشکی شهید بهشتی آناهیتا مرامی anahita marami مازیار میر maziyar mir

سابقه و هدف: امروزه ثبت رادیوگرافی جانبی سر در وضعیت طبیعی سر (nhp) توصیه شده و قابلیت تکرار بالایی برای آن عنوان شده است، ولی مطالعات طولانی مدت کمی بر روی تکرار پذیری این وضعیت صورت گرفته است. لذا این مطالعه با هدف تعیین فتوگرافیک قابلیت تکرار وضعیت طبیعی سر پس از گذشت سه سال طراحی شد.مواد و روشها: این مطالعه یک مطالعه توصیفی از نوع longitudinal بر روی 27 نفر از دانشجویان داوطلب دانشکده دندان...

Journal: :European journal of cancer 2011
Åke Västermark Yvonne Lundberg Giwercman Oskar Hagströmer Ewa Rajpert De-Meyts Jakob Eberhard Olof Ståhl Gabriella Cohn Cedermark Hamideh Rastkhani Gedske Daugaard Stefan Arver Aleksander Giwercman

Increasing incidence of testicular germ cell cancer (TGCC) is most probably related to environment and lifestyle. However, an underlying genetic predisposition may play a role and since sex steroids are assumed to be important for the rise and progression of TGCC, a study of androgen receptor (AR) gene polymorphisms in relation to the risk, histological type and progression of TGCC was undertak...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید