Density functional theory calculations have been used to analyze the electronic and magnetic properties of ultrathin zigzag graphene nanoribbons (ZGNRs) with different edge saturations. We have compared a symmetric hydrogen saturation of both edges with an asymmetric saturation in which one of the edges is saturated with sulphur atoms or thiol groups, while the other one is kept hydrogen satura...

It was the aim of this study to determine the potential of two aliphatic and two aromatic thiolated chitosan conjugates: chitosan-thioglycolic acid (chitosan-TGA), chitosan-4-thiobutylamidine (chitosan-TBA), chitosan-6mercaptonicotinic acid (chitosan-6MNA) and chitosan-4-mercaptobenzoic acid (chitosan-4MBA), respectively, as permeation enhancing agents. Ritonavir was employed as model compound....

Core-shell magnetic nanoparticles have received significant attention recently and are actively investigated owing to their large potential for a variety of applications. Here, the synthesis and characterization of bimetallic nanoparticles containing a magnetic core and a gold shell are discussed. The gold shell facilitates, for example, the conjugation of thiolated biological molecules to the ...

Recently, the X-ray determined structure of the thiolated Au18 cluster has been reported. In this communication, we addressed a study of structures and chiroptical properties of thiolated Au18 cluster doped with up to ten Ag atoms, which have been calculated by Time Dependent Density Functional Theory (TD-DFT). The number of Ag atoms was steadily varied and more stable isomers showed optical an...

The surface plasmon resonance (SPR) effect endows gold nanoparticles (GNPs) with the ability to visualize biomolecules. In the present study, we designed and constructed a GNP probe to allow the semi-quantitative analysis of methylated tumor suppressor genes in cultured cells. To construct the probe, the GNP surfaces were coated with single-stranded DNA (ssDNA) by forming Au-S bonds. The ssDNA ...

Listeria monocytogenes (L. monocytogenes), one of most problematic food-borne bacteria, is mainly transmitted through the food chain and may cause listeriosis. Therefore, the development of rapid and sensitive L. monocytogenes detection technique has become an urgent task. In this study, we proposed a method using hyperbranching rolling circle amplification (HRCA) combined with gold nanoparticl...

The electrochemistry of DNA films modified with different redox probes linked to DNA through saturated and conjugated tethers was investigated. Experiments feature two redox probes bound to DNA on two surfaces: anthraquinone (AQ)-modified uridines incorporated into thiolated DNA on gold (Au) and 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO)-modified uridines in pyrene-labeled DNA on highly orien...

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing 5? thiolated 60-mer DNA aptamer (i.e., 5?-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3?). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle...

In this paper we report the observation of enhanced field emission properties from thiolated multi-wall carbon nanotubes (MWCNTs) produced by a simple and effective two-step chemical surface modification technique. This technique implements carboxylation and thiolation on the MWCNTs synthesized by microwave plasma chemical vapor deposition (MPCVD) on the flexible carbon cloth substrate. The res...