Background & objective:  Tuberculosis (TB) remains a major cause of death around the world. Bacillus Calmette Guérin (BCG) is the only vaccine used in TB prevention that has a protective effect in children, but its effectiveness declines in adults. Design and development of new vaccines is the most effective way against TB. The aim of this study was to design and construc...

tomato ringspot virus (torsv) is a member of the genus nepovirus, family secoviridae, causing substantial economically declining in perennial crops, including stone fruits, worldwide. during the years 2008 and 2009 a total number of 414 symptomatic and asymptomatic leaf samples were randomly collected from different stone fruit trees including peach, apricot, plum and sour cherry from fars and ...

background: linear dermatitis is endemic in iran where most cases occur in the caspian sea coast and fars prov­ince. the disease is caused by beetles of the genus paederus which are active from early spring to beginning of au­tumn although its incidence rises from may to august. the classic taxonomy of paederus spp. is based on the male genitalia that is very complex and needs expertise. in thi...

background: the diagnosis of ocular toxoplasmosis is mainly based on clinical features. however, ocular fluid testing by pcr may be very helpful for approval or rejection of this etiology. in this study, we utilized a nested-pcr technique, targeting the b1 partial sequence to analyze the aqueous and vitreous samples for evaluating the presence of the toxoplasma dna. methods: fifty aqueous or vi...

Specific and non-specific complexes of DNA and photolyase are visualised by atomic force microscopy. As a substrate for photolyase a 1150 bp DNA restriction fragment was UV-irradiated to produce damaged sites at random positions. Comparison with a 735 bp undamaged DNA fragment made it possible to separate populations of specific and non-specific photolyase complexes on the 1150 bp fragment, rel...

The ovine melatonin receptor 1A (MTNR1A) and aromatase (CYP19) genes were structurally characterized and the association between their variants and reproductive and growth traits was studied in Kurdi sheep at Kurdi sheep breeding station located in Shirvan, Iran. The genomic DNA was extracted by guanidine thiocyanate-silica gel method. Polymerase chain reaction was carried out to amplify 824 bp...

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...