نتایج جستجو برای: sffsfr primer

تعداد نتایج: 31155  

2009
Cheng-Hong Yang

Before performing polymerase chain reactions (PCR), a feasible primer set is required. Many primer design methods have been proposed for design a feasible primer set. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specifi...

Journal: :Information Technology and Libraries 2013

Journal: :Journal of oral science 2009
André L Faria-e-Silva Rafael R Moraes Fabrício A Ogliari Evandro Piva Luis R M Martins

This study evaluated the rate of polymerization (R(p)) and degree of conversion (DC) of Panavia F when self- or dual-activated, and the influence of either using or not using a primer containing co-initiators (ED Primer) mixed with the material. The conversion reaction was monitored using real-time infrared spectroscopy with an attenuated total reflectance device. The cement was mixed, put onto...

Journal: :Nihon Hotetsu Shika Gakkai zasshi 2008
Kazuya Yamada Hiroyasu Koizumi Yumi Ishikawa Hideo Matsumura

PURPOSE The aim of this study was to assess the effect of acidic primers on adhesive bonding to prefabricated alumina material designed for fixed restorations. METHODS High-purity alumina disks (Procera AllCeram) were primed with one of the following materials: Acryl Bond, All Bond II Primer B, Alloy Primer, Estenia Opaque Primer, M.L. Primer, MR. Bond, and Super- Bond Liquid. The specimens w...

Journal: :medical journal of islamic republic of iran 0
salah rahmani dept. of medical biotechnology and the 3 dept. of medical bacteriology, school of medical sciences, tarbiat modarres uniسازمان های دیگر: educational and research center of medical laboratoly sciences, iran university of medical sciences (iums), tehran, iran mehdi forozandeh dept. of medical biotechnology and the 3 dept. of medical bacteriology, school of medical sciences, tarbiat modarres un mirlatif mosavi dept of biology, imam hossein university, tehran,سازمان اصلی تایید شده: دانشگاه تربیت مدرس (tarbiat modares university) abbas rezaee dept. of medical bacteriology, school of medical sciences, tarbiat modarres university, tehran

background: there is a conserved portion in the 16s rrna gene of bacteria which can be amplified by the universal pcr method. this fragment is 996 bp in length. in this method, only one set of universal primers is used for the amplification of the conserved region of the 16s rrna gene, in common bacterial pathogens. therefore, using the universal pcr method, these bacteria are detectable only b...

2006
Louise K. Stanley Ralf Seidel Carsten van der Scheer Nynke H. Dekker Mark D. Szczelkun Cees Dekker

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

2016
Frank Vandenbussche Elisabeth Mathijs David Lefebvre Kris De Clercq Steven Van Borm

Non-specific tail sequences are often added to the 5'-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foo...

Journal: :Journal of virology 1997
W Fu B A Ortiz-Conde R J Gorelick S H Hughes A Rein

In an early step in the retroviral infectious process, reverse transcriptase copies the genomic RNA of the virus into complementary minus-strand DNA. The primer for this synthetic event is a molecule of cellular tRNA, which is annealed by its 3' 18 nucleotides to a region of the genomic RNA termed the primer-binding site (PBS); the sequence of the PBS and hence the identity of the tRNA depend u...

Journal: :Bioinformatics 2003
Ming-Hua Hsieh Wei-Che Hsu Sung-Kay Chiu Chi-Meng Tzeng

SUMMARY We have developed U-PRIMER, a primer design program, to compute a minimal primer set (MPS) for any given set of DNA sequences. The U-PRIMER algorithm, which uses automatic variable fixing and automatic redundant constraint elimination to tackle the binary integer programming problem associated with the MPS selection problem. The program has been tested successfully with 32 adipocyte dev...

2002
Kermit Sigmon

The Third Edition of the MATLAB Primer is based on version 4.0/4.1 of MATLAB. While this edition reflects an extensive general revision of the Second Edition, most significant is the new information to help one begin to use the major new features of version 4.0/4.1, the sparse matrix and enhanced graphics capabilities. You are advised to download anew each term the latest printing of the Primer...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید