Before performing polymerase chain reactions (PCR), a feasible primer set is required. Many primer design methods have been proposed for design a feasible primer set. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specifi...

This study evaluated the rate of polymerization (R(p)) and degree of conversion (DC) of Panavia F when self- or dual-activated, and the influence of either using or not using a primer containing co-initiators (ED Primer) mixed with the material. The conversion reaction was monitored using real-time infrared spectroscopy with an attenuated total reflectance device. The cement was mixed, put onto...

PURPOSE The aim of this study was to assess the effect of acidic primers on adhesive bonding to prefabricated alumina material designed for fixed restorations. METHODS High-purity alumina disks (Procera AllCeram) were primed with one of the following materials: Acryl Bond, All Bond II Primer B, Alloy Primer, Estenia Opaque Primer, M.L. Primer, MR. Bond, and Super- Bond Liquid. The specimens w...

background: there is a conserved portion in the 16s rrna gene of bacteria which can be amplified by the universal pcr method. this fragment is 996 bp in length. in this method, only one set of universal primers is used for the amplification of the conserved region of the 16s rrna gene, in common bacterial pathogens. therefore, using the universal pcr method, these bacteria are detectable only b...

pRSgap (Supplementary Figure 3B) was constructed from pBluescriptII SK+ (Stratagene) by inserting 4 PCR fragments derived from λ-DNA into the multiple cloning site of the vector. PCR fragment 1 (forward primer: AAAATCTAGAAGTTCAGGAAGCGGTGATGCTG, reverse primer AAAAGAGCTCTTGGGCGGTTGTGTACATCGAC) copies the 4236 to 6137 bp region from λ-DNA. After digestion with the corresponding restriction enzyme...

Non-specific tail sequences are often added to the 5'-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foo...

In an early step in the retroviral infectious process, reverse transcriptase copies the genomic RNA of the virus into complementary minus-strand DNA. The primer for this synthetic event is a molecule of cellular tRNA, which is annealed by its 3' 18 nucleotides to a region of the genomic RNA termed the primer-binding site (PBS); the sequence of the PBS and hence the identity of the tRNA depend u...

SUMMARY We have developed U-PRIMER, a primer design program, to compute a minimal primer set (MPS) for any given set of DNA sequences. The U-PRIMER algorithm, which uses automatic variable fixing and automatic redundant constraint elimination to tackle the binary integer programming problem associated with the MPS selection problem. The program has been tested successfully with 32 adipocyte dev...

The Third Edition of the MATLAB Primer is based on version 4.0/4.1 of MATLAB. While this edition reflects an extensive general revision of the Second Edition, most significant is the new information to help one begin to use the major new features of version 4.0/4.1, the sparse matrix and enhanced graphics capabilities. You are advised to download anew each term the latest printing of the Primer...