نتایج جستجو برای: bombyx

تعداد نتایج: 4027  

Journal: :iranian journal of radiation research 0
s.r. hosagoudar genomics and proteomics laboratory, department of sericulture, karnatak university, dharwad 580 003, karnataka, india h.b. manjunatha genomics and proteomics laboratory, department of sericulture, karnatak university, dharwad 580 003, karnataka, india

background: in the light of various applications of uv laser in biological system, we have investigated the effect of picosecond uv laser radiation on silkworm bombyx mori. materials and methods: the eggs of nb4d2 of different stages were exposed to pico second pulse laser at 355 nm from nd:yag laser for different durations. results: due to irradiation alterations in crescent larval body markin...

Journal: :Development 1994
M Myohara

Bombyx eggs at the fertilization stage (0-2 hours after oviposition) were irradiated with a scanning UV-laser microbeam (355 nm) over an area of about 1% of the total egg surface. In spite of absence of nuclei or cells at the irradiated sites, larvae from treated eggs showed localized cuticle defects in the integument. The location and frequency of the defects within the cuticular pattern corre...

Journal: :caspian journal of environmental sciences 2005
s.c. kochi b.b. kaliwal

topical application with 100, 200 and 300 ng/ml phytohormone salicyclic acid on commercial traits was analysed in bivoltine csr2, csr4 and csr2xcsr4 crossbreed races of the silkworm, bombyx mori l. the results showed that there was significant increase in larval weight female cocoon weight, male cocoon shell weight, and hatching percentage with 100 and 200 ng/ml, silkgland weight, female cocoon...

Journal: :Bioscience, biotechnology, and biochemistry 2005
Pingbo Zhang Kohji Yamamoto Yoichi Aso Yutaka Banno Daisuke Sakano Yongqiang Wang Hiroshi Fujii

It is recognized that P25 is one of three polypeptide components of the fibroin synthesized in the larval silk gland (SG) of silkworm, having two glycosylated isoforms. In the present study, however, eight P25 isoforms were separated by proteomics, including two-dimensional gel electrophoresis of whole SG proteins, and were identified by the peptide mass fingerprinting method. Four of the eight...

Journal: :Sains Malaysiana 2022

Silkworm (Bombyx mori) has been reported to exhibit diverse health benefits. A comparative study was conducted evaluate the physicochemical (colour, water activity, pH, solubility, proximate, mineral, amino acid, and fatty acid composition) microbiological qualities of Bombyx mori silkworm powder produced from two developmental stages (larvae pupae). pupae (SPP) had significantly higher (p<0...

Journal: :Nucleic acids research 1986
A Fournier M A Guérin J Corlet S G Clarkson

SEQUENCE AND ITS ORIGIN: 240 bp of pBma5, a -2.8 kb //mdlll-fiamHI fragment subcloned in pBR327. The fragment is derived from the 10.4 kb insert of the lambda recombinant I^Ad isolated from a Bombyx mori genomic library (Fig. 1 of Fournier et al., 1984). . 60 AAGCTTTGTAGTATAATTTCGTCAGTTCATAATCCTCCTGGTATGTATGAAGATTTTCTT . 120 TTGAAAACCTATCAGCTATTTTTAACGGTAGTGGATAGCCCGGCTAGCTCAGTCGGTAGA . 180 GCA...

Journal: :The Journal of General Physiology 2003
F. L. Campbell

The susceptibility of the silkworm to arsenic decreases during its larval development. Relative susceptibility may be expressed numerically as a ratio of areas under dosage-effect curves.

Journal: :Entomology and applied science letters 2023

Zingiberene is a constituent of Zingiber officinale (L), structurally monocyclic sesquiterpene, and possesses immense pharmacological activity. The present attempt was aimed to utilize methanol solution zingiberene for topical application at forty-eight hours after the fourth molt fifth instared larvae silkworm, Bombyx mori (L) [Race: Double Hybrid - (CSR6 x CSR26) CSR2 CSR27)]. found significa...

Journal: :The Canadian Entomologist 1900

Journal: :caspian journal of environmental sciences 2007
s.e. neelagund s.s. ingalhalli c.j. savanurmath s.b. hinchigeri3 m.b hiremath

antiviral proteins (avp), present in silkworm fecal matter, show activity against nuclear polyhedrosis virus (npv) in vitro and in vivo. the extract of silkworm fecal matter prepared in phosphate buffer solution of ph 7.5 was subjected to 50% solid ammonium sulfate precipitation to enrich avp, then which was dialyzed. the dialysate was applied to the column containing silica gel-g, the column e...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید