We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophor...

Transcriptional regulation of the Ig heavy chain gene involves several regulatory elements, including the 3'alpha enhancer, which is composed of four distinct regulatory domains. DNA binding sites for several transcription factors, including B cell-specific activator protein, nuclear factor for immunoglobulin kappa chain in B cells, and octamer have been identified within the 3'alpha enhancer d...

The clinical and pathological features of 18 new patients with alpha heavy chain disease seen at two referral centres in Baghdad, Iraq, are described. The series included 14 males and four females ranging in age from 14 to 47 years. Almost all patients presented because of long-standing abdominal pain and diarrhoea. The tissue diagnosis and extent of the disease were established at laparotomy i...

The sarcomeric proteins and organization of cardiac myofibrils appeared intact in multiple unrelated patients with hypertrophic cardiomyopathy. In two subjects demonstrating the missense mutation at position 403 (Arg to Gln) in the beta-myosin heavy chain gene, total myosin and immunoreactive beta-myosin heavy chain levels were similar to those found in other patients with hypertrophic cardiomy...

Skinned fibers from the normal human heart with the beta-myosin heavy chain (ventricular fibers) revealed both a higher force generation per cross section and a higher Ca2+ sensitivity than skinned fibers with the alpha-myosin heavy chain (atrial fibers). The relation between isometric ATPase activity and isometric tension of atrial fibers was higher than that of ventricular fibers. Since the A...

Five patients suffering from alpha chain disease are described. Clinically the patients presented with clubbing and the symptoms of malabsorption. There was a characteristic, predominantly plasma cell infiltrate of the wall of the small intestine. Spread of the plasmacytosis beyond the small intestine to bone marrow (1), peripheral blood (1), and probably the nasopharyngeal lymphoid tissue (1) ...

Outer-arm dynein from the sperm of the sea urchin S. purpuratus was adsorbed to mica flakes and visualized by the quick-freeze, deep-etch technique. Replicas reveal particles comprised of two globular heads joined by two irregularly shaped stems which make contact along their length. One head is pear-shaped (18.5 X 12.5 nm) and the other is spherical (14.5-nm diam). The stems are decorated by a...

Two myosin heavy chain cDNA clones (251 and 110), constructed from chick embryonic skeletal muscle mRNA, were subjected to extensive DNA sequence analysis. A complete description of the DNA sequence of clone 251 was obtained. This 1.5-kilobase pair cDNA sequence specified the COOH-terminal 439 amino acids of the myosin heavy chain, and included the entire 3' nontranslated region. The translated...

Chick heart development was studied using transmission electron microscopy and SDS-polyacrylamide gel electrophoresis in combination with densitometry. Myosin heavy chain, alpha-actinin, actin and tropomyosin accumulations were analysed in developing hearts from preheartbeat stage 9 (Hamburger-Hamilton staging series) through 2 days after hatching. At the preheartbeat stage, electron microscopy...