نتایج جستجو برای: mycoplasma capricolum subsp capricolum
تعداد نتایج: 29051 فیلتر نتایج به سال:
The genes for presumably all the tRNA species in Mycoplasma capricolum, a derivative of Gram-positive eubacteria, have been cloned and sequenced. There are 30 genes encoding 29 tRNA species. This number is the smallest in all the known genetic systems except for mitochondria. The sequences of 9 tRNA genes of them have been previously reported (1-3). Twenty-two genes are organized in 5 clusters ...
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the ge...
Mycoplasma capricolum subsp capricolum (Mcc) is one of the etiological agents of contagious agalactia(C.A) in goats which can cause significant economic losses. The aim of this study was to detect Mcc from goats of Qom province in Iran. A total of 111 samples were collected from suspected goats to C.A and cultured in PPLO broth supplemented for Mcc isolation. The bacteria DNAs were extracted ...
The nucleotide sequence of the 1.3 kilobase-pair DNA segment, which contains the genes for ribosomal proteins S8 and L6, and a part of L18 of Mycoplasma capricolum, has been determined and compared with the corresponding sequence in Escherichia coli (Cerretti et al., Nucl. Acids Res. 11, 2599, 1983). Identities of the predicted amino acid sequences of S8 and L6 between the two organisms are 54%...
A study was implemented to investigate the presence of contagious caprine pleuropneumonia (CCPP) in East Turkey. This study was based on clinical surveillance in the field, surveillance at regional slaughterhouses and regular submission of suspected lesions to regional laboratories. The results showed that the agent of CCPP, Mycoplasma capricolum subspecies capripneumoniae (Mccp), could be dete...
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید