The objectives of this study were to determine the effects of a single gene and composite genotype of the casein gene family, including the beta-lactoglobulin gene (beta-LGB), acyl-CoA: diacylglycerol acyltransferase 1 gene (DGAT1), growth hormone gene (GH), and luteinizing hormone receptor gene (LHR) on milk yield, milk composition, the percentage of fat, protein, solids-not-fat, and total sol...

Background: One important reproductive characteristic of Mammals is the production of milk to nurse the neonate. In order to better understand the evolution of milk we have investigated gene expression in milk cells from monotremes which are the most ancient representative of the mammalian lineage. Materials and Methods: Using a milk cell cDNA sequencing approach we characterise milk protein se...

Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...

Alpha s1-, alpha s2-, beta- and kappa-caseins from Somali camels (Camelus dromedarius) were purified by acid precipitation at pH 4.4, crudely separated into an alpha-CN and a beta-CN fraction and further purified by reversed-phase HPLC. Fragments of tryptic digests were sequenced. Amino acid patterns obtained were used to screen a cDNA library constructed from mRNA from lactating udder tissue. ...

The structure of thin casein films prepared with spin-coating is investigated as a function of the calcium concentration. Grazing incidence small-angle x-ray scattering and atomic force microscopy are used to probe the micelle structure. For comparison, the corresponding casein solutions are investigated with dynamic light-scattering experiments. In the thin films with added calcium three types...