BISTRO-PRIMER TOOL TO DESIGN AND VALIDATE SPECIFIC PCR PRIMER PAIRS FOR PHYLOGENETIC ANALYSIS Praful Aggarwal Marquette University, 2011 Polymerase Chain Reaction is a widely used biological technique which helps in amplifying small quantities of DNA. These amplified DNA copies are then used in several other experiments like DNA sequencing, phylogenetic analysis, etc. PCR primers are short subs...

We have determined the nucleotide sequence of the rat hprt (hypoxanthine phosphoribosyltransferase; EC 2.4.2.8.) mRNA coding region and of adjacent, untranslated 5' and 3' mRNA, and we have designed an oligonucleotide primer pair for efficient PCR amplification of the rat hprt coding region. These sequence data and rat-specific primer pair will aid workers interested in coupling well-developed ...

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of prime...

Correction We have previously demonstrated the expression of inhibin subunits in endometrial tissues and used b-actin primer pairs to perform a PCR analysis loading control [1]. However, instead of using the mentioned b-actin primer pairs from a commercial molecular biology supplier, we used the b-actin primer pair listed in Table 1. All depicted primer pairs in Table 1 were designed and establ...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

The main areas for field-grown vegetable production in Iran were surveyed during the years of 2012-2014 to determine the occurrence of begomoviruses infecting these crops. A total of 787 leaf samples were collected from vegetables and some other host plants showing virus-like symptoms and tested by an enzyme-linked immunosorbent assay (ELISA) using polyclonal antibodies produced against Tomato ...

We have determined the nucleotide sequence and mapped the transcriptional boundaries in the long terminal repeats (LTRs) and adjacent regions of a retrovirus transmissible virus-like 30S ( VL30 ) mouse genetic element. The 572 base pair LTRs contain transcriptional regulatory sequences and are bounded by short imperfect repeats, with a minus strand tRNAgly primer binding site and a purine rich ...

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential thr...

A unique oligonucleotide pair, GOCC56:GOCC427, was designed that correctly primed specific amplification of a approximately 370-bp sequence spanning the ITS and 5.8S rDNA regions of Glomus occultum and Glomus brasilianum. In addition, this primer pair successfully detected G. occultum and G. brasilianum DNA in nested PCR using a primary PCR product amplified from highly diluted extracts of colo...