High multivitamin gestational diets (HV, 10-fold AIN-93G levels) increase body weight (BW) and food intake (FI) in rat offspring weaned to a recommended multivitamin (RV), but not to a HV diet. We hypothesized that high vitamin A (HA) alone, similar to HV, in post-weaning diets would prevent these effects of the HV maternal diet consistent with gene expression in FI and reward pathways. Male of...

BACKGROUND Ventilator-induced lung injury (VILI) is associated with inflammatory responses in the lung. Thrombomodulin (TM), a component of the coagulation system, has anticoagulant and anti-inflammatory effects. We hypothesized that the administration of recombinant human soluble TM (rhsTM) would block the development of lung injury. METHODS Lung injury was induced by high tidal volume venti...

Malnutrition may be a predisposing host factor in the development of exogenous-reinfection tuberculosis. Outbred Hartley guinea pigs were given isocaloric diets containing either 30% ovalbumin (control animals) or 10% ovalbumin (low-protein-fed [LP] animals). Equal numbers of control and LP animals were assigned to one of three infection groups: (i) primary pulmonary infection with a low-virule...

BACKGROUND Fluid resuscitation is a core stone of hemorrhagic shock therapy, and crystalloid fluids seem to be associated with lower mortality compared to colloids. However, as redistribution starts within minutes, it has been suggested to replace blood loss with a minimum of a three-fold amount of crystalloids. The hypothesis was that in comparison to high volume (HV), a lower crystalloid volu...

In human protein turnover studies with isotopically labeled leucine (Leu) as a tracer, plasma ketoisocaproate (KIC) enrichment is extensively used as a surrogate measure of intracellular leucine enrichment. To test how accurately arterial ketoisocaproate (A-KIC) represents leucine isotopic enrichment in the hepatic (HV) and femoral veins (FV), which drain liver and muscle beds, we measured Leu ...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

BACKGROUND Hallux valgus (HV) is a foot deformity commonly seen in medical practice, often accompanied by significant functional disability and foot pain. Despite frequent mention in a diverse body of literature, a precise estimate of the prevalence of HV is difficult to ascertain. The purpose of this systematic review was to investigate prevalence of HV in the overall population and evaluate t...

AIM The aim of the present study was to assess the change in physical properties (surface roughness, surface hardness and phase transformation) after surface grinding of zirconia by using three commercially available abrasives. MATERIALS AND METHODS Thirty sintered zirconia specimens were prepared and divided into three groups namely Group M (grinded using Mani Dia diamond bur standard grit),...