In this study, we show that administration of low-dose melphalan (l -PAM, l -phenylalanine mustard) to mice bearing a large MOPC-315 plasmacytoma led to a rapid up-regulation of B7-1 (CD80), but not B7-2 (CD86), expression on the surface of MOPC-315 tumor cells. This l -PAM-induced preferential up-regulation of B7-1 surface expression was due, at least in part, to a direct effect of l -PAM on t...

A biodegradable polysaccharide-based inhibitor is grafted with polyacrylamide (PAM) for oilfields’ sweet corrosion. The green properties of agar and PAM were incorporated to synthesize an agar-grafted-PAM (AGGPAM) inhibitor. Electrochemical tests Tafel AC impedance, used determine the corrosion rate carbon steel (C-steel) protection efficiency in CO2-saturated 3.5 wt% NaCl solution. surface mor...

Polyacrylamide (PAM) in furrow irrigation water eliminates 94% of runoff sediment. Higher infiltration (15-50%) can result in upperfield uverirrigation. We hypothesized that PAM would lengthen advance time, but that interactions with flow rate and wheel-track (WT) Ihrrows would occur, influencing erosion and infiltration with potential for improved water management. A 2-yr study conducted on 1....

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...

A fatal case of primary amoebic encephalitis (PAM) in a 20 year old boy, a proven case of acute leukemic leukemia (ALL) type L2, in remission is described. No history of swimming could be elicited. The clinical presentation, the isolation of the amoeba from the cerebrospinal fluid (CSF), the poor response to amphotericin B, and the ultimately fatal outcome are all consistent with the diagnosis ...

Drilling waste is a problem that affects the environment, society, and health. However, rheological additive in drilling fluid source of generation waste. Hence, suitable became concern bored pile construction. Conventional bentonite has been replaced by usage polymer operations, this due to operational, environmental, economic aspects. Unlike bentonite, polyacrylamide (PAM) high molecular weig...

Peptidylglycine alpha-amidating monooxygenase (PAM) catalyzes the COOH-terminal amidation of bioactive peptides through a two step reaction catalyzed by separate enzymes contained within the PAM precursor. To characterize the trafficking of integral membrane PAM proteins in neuroendocrine cells, we have generated stable AtT-20 cell lines expressing full length and COOH-terminally truncated inte...

Tuberous Sclerosis Complex (TSC) is an autosomal dominant disorder associated with mutations in TSC1, which codes for hamartin, or TSC2, which codes for tuberin. The brain is one of the most severely affected organs, and CNS lesions include cortical tubers and subependymal giant cell astrocytomas, resulting in mental retardation and seizures. Tuberin and hamartin function together as a complex ...

A series of nitrogen-doped carbons (NCs) were prepared by the pyrolysis (300–900 °C) crystalline polyazomethine (PAM) synthesized via a facile condensation reaction in methanol solvent. The controlled solvent evaporation resulted PAM crystals form nanosheet clusters with sheet thickness ~50 nm. Such architecture was maintained after pyrolysis, obtaining porous CNs high specific surface areas up...

Peptidylglycine alpha-amidating monooxygenase (PAM) catalyzes the COOH-terminal alpha-amidation of neuro-endocrine peptides through the sequential action of monooxygenase and lyase domains contained within this bifunctional protein. Alternative splicing leads to the expression of soluble and integral membrane bifunctional PAM proteins as well as a soluble monofunctional monooxygenase. In order ...