نتایج جستجو برای: 2865

تعداد نتایج: 123  

Journal: :Journal of Applied Entomology 2023

Although several insect orders have been deeply studied in plant–animal interactions (e.g. pollination) cockroaches traditionally ignored taxonomic and ecological studies. However, they could be playing a role the reproduction of plants. To date, 8 plant species use as pollination agent. In our study, we reviewed 2865 records from citizen science platforms own data Iberian Peninsula to find flo...

Journal: :Atmosphere 2022

The post-synthesis modification is a highly efficient method for the of Metal-organic framework (MOF) materials, which has been used to synthesize MOF materials purposefully that cannot be prepared by direct synthesis and impregnation method. In this work, amino modified ZIF8 with 5-aminotetrazole was post employed reversibly remove SO2 from flue gas. Based on characterization analysis X-ray di...

2018
Shreya Kothari Carla J. Berg

INTRODUCTION Given the increase in hookah use among young adults, characteristics of hookah use/users, as well as reasons for its use or discontinuation among young adults, are critical to understand. METHODS Data from a study of 18–25 year olds from seven Georgia colleges/universities (n=2865) were analyzed to examined: 1) differences in socio-demographics and other substance use among current...

2017
Xiaoxiao Wang Qimei Wang Wei Cheng Zhao Yu Feng Ling Haiyan Mao Enfu Chen

Live bird markets (LBMs), being a potential source of avian influenza virus, require effective environmental surveillance management. In our study, a total of 2865 environmental samples were collected from 292 LBMs during the 2015-2016 human influenza season from 10 cities in Zhejiang province, China. The samples were tested by real-time quantitative polymerase chain reaction (RT-PCR). Field in...

2013
Diane J. Schiano Thomas Debeauvais

World of Warcraft (WoW) is a massively multiplayer online game (MMO) supporting rich and complex social interactions among well over 10 million players worldwide. In this study, we explore implications of the pervasive “lonely gamer” stereotype, which portrays online gamers as socially isolated and addicted young people, usually male, with few real-life (RL) social ties. This is the first study...

2015
Seung-Woon Rha Cheol Ung Choi Jin Oh Na Hong Euy Lim Jin Won Kim Eung Ju Kim Chang Gyu Park Hong Seog Seo Dong Joo Oh Hyeon-Cheol Gwon Byeong-Keuk Kim Hyo-Soo Kim Cheol Woong Yu Hun Sik Park In-Ho Chae Seung-Hwan Lee Moo Hyun Kim Seung-Ho Hur Young-Keun Ahn Yangsoo Jang

OBJECTIVE This study aimed to compare 1-year clinical outcomes in diabetic and nondiabetic patients with chronic total occlusion (CTO) lesions. METHODS A total of 2865 patients (age 62.82±10.64 years; 74.0% men) undergoing percutaneous coronary intervention for CTO were analyzed. The patients were classified as diabetic (n=977) or nondiabetic (n=1888). One-year clinical outcomes were compared...

2012
V. Stalin Raj Saskia L. Smits Suzan D. Pas Lisette B.V. Provacia Hanneke Moorman-Roest Albert D.M.E. Osterhaus Bart L. Haagmans

Table 1. Primers used for amplification and sequencing of the ferret HEV genome* Primer Sequence, 5 3 Nucleotide position† FRHEV-F1 GGCTGGCGTTTGCTTGGAGG 256–275 FRHEV-R1 TTCGAATCCAACGCTGGTGAC 1158–1178 FRHEV-F2 GTACTATCACGGCCAATGAG 1077–1096 FRHEV-R2 CAGCCTATAGGGCATAGTAAG 1681–1701 FRHEV-F3 GCCCTGACCTTGGAGCTGAC 1592–1611 FRHEV-R3 CTATTGGCGGCGTTAACTAG 2078–2097 FRHEV-F4 GAGCTTTTGCCGGATGGGTC 2015...

2016
Claire Berticat Frédéric Thomas Yves Dauvilliers Isabelle Jaussent Karen Ritchie Catherine Helmer Christophe Tzourio Michel Raymond Sylvaine Artero

The evolutionary reasons for sleep remain controversial. The immune theory of sleep suggests that sleep is essential to the immune system, allowing organisms to allocate more energy to their immunity. This hypothesis was tested by exploring the links between excessive daytime sleepiness (EDS) and vulnerability to infectious diseases in a large (n = 9294) cohort of elderly individuals, with info...

2016
Simon Jacques Simone Lemieux Benoît Lamarche Catherine Laramée Louise Corneau Annie Lapointe Maude Tessier-Grenier Julie Robitaille

Twenty-four-hour dietary recalls can provide high-quality dietary intake data, but are considered expensive, as they rely on trained professionals for both their administration and coding. The objective of this study was to develop an automated, self-administered web-based 24-h recall (R24W) for a French-Canadian population. The development of R24W was inspired by the United States Department o...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید