نتایج جستجو برای: porphyra

تعداد نتایج: 568  

2014
M. Yang N. Her J. Ryu Y. Yoon

Perchlorate and iodide concentrations were determined in brown (Undaria pinnatifida and Laminaria japonica) and red (Porphyra sp.) edible seaweeds, which are commonly consumed by Korean people, with the use of ion chromatography, coupled with a tandem mass spectrometer. Seaweeds (i.e., good sources of iodine) are among the most important plant life in the ocean and commonly consumed as food and...

2015
P. Nazni S. Deepa

The main aim of the study was to evaluate the various minerall and heavy metals parameters of seaweeds present in the south coastal line. The five red seaweeds namely Acanthophora deliei, Scinaia furcellata, Porphyra tenera, Gracilaria verucosa and Hypnea species were collected from the Pamban, South east coast India. These samples were analyzed for its mineral contents such as sodium, potassiu...

Journal: :Botanical Gazette 1922

Journal: :The British journal of nutrition 2009
Maria N García-Casal José Ramírez Irene Leets Ana C Pereira Maria F Quiroga

Marine algae are easily produced and are good sources of Fe. If this Fe is bioavailable, algae consumption could help to combat Fe deficiency and anaemia worldwide. The objective of the present study was to evaluate Fe bioavailability, polyphenol content and antioxidant capacity from three species of marine algae distributed worldwide. A total of eighty-three subjects received maize- or wheat-b...

Journal: :Journal of photochemistry and photobiology. B, Biology 2005
Nathalie Korbee Félix L Figueroa José Aguilera

The effect of different light qualities (white, blue, green, yellow and red light) on photosynthesis, measured as chlorophyll fluorescence, and the accumulation of photosynthetic pigments, proteins and the UV-absorbing mycosporine-like amino acids (MAAs) was studied in the red alga Porphyra leucosticta. Blue light promoted the highest accumulation of nitrogen metabolism derived compounds i.e., ...

2013
Ehsan Nazifi Naoki Wada Minami Yamaba Tomoya Asano Takumi Nishiuchi Seiichi Matsugo Toshio Sakamoto

Mycosporine-like amino acids (MAAs) are water-soluble UV-absorbing pigments, and structurally different MAAs have been identified in eukaryotic algae and cyanobacteria. In this study novel glycosylated MAAs were found in the terrestrial cyanobacterium Nostoc commune (N. commune). An MAA with an absorption maximum at 334 nm was identified as a hexose-bound porphyra-334 derivative with a molecula...

2012
Linwen He Aiyou Huang Songdong Shen Jianfeng Niu Guangce Wang

Porphyra yezoensis Ueda is an intertidal marine red algae that has received increasing attention as a model organism owing to its important role in biological research and the agronomic industry. The two generations of Porphyra yezoensis, the sporophyte and the gametophyte, have the same genome but show great differences in many aspects, including structural features, habitat, and gene expressi...

Journal: :Nucleic acids research 1982
F Takaiwa M Kusuda N Saga M Sugiura

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

2014
Pei-Chun Chao Cheng-Chin Hsu Wen-Hu Liu

Background: Purple laver ((Porphyra dentate) is a popular edible seaweed in Asia. This study examined protective effects of extract from purple laver extract (PLE) in diabetic mice. Methods: Content of carotenoids and anthocyanins in PLE was analyzed. PLE at 0.5 and 1% was supplied for 7 weeks. Results: PLE was rich in anthocyanins. PLE intake at 0.5 and 1% lowered plasma glucose level (P<0.05)...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید